HUGE |
Gene/Protein Characteristic Table for KIAA1398 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06702 |
---|---|
Accession No. : | AB037819 |
Description : | Ribosome-binding protein 1. |
HUGO Gene Name : | |
Clone Name : | ha02572 [Vector Info] |
Flexi ORF Clone : | pF1KA1398
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced hk01703, former representative clones for KIAA1398 with ha02572. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5468 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 501 bp Genome contig ID gi51511747r_17442325 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
GTGTTGATGCCATTAAAACCAACGTTGGTGCCCGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TGCTGCGGTCTCGTCTGGTCTTCTGCTGGGGCTCCCCCACCCGCTGTTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 17542325 17610847 26 99.0 Both No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1586 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGTGAAGAACAATGACCTCCG | |
: CTCGGTGTAATTCTGTTGTGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: ATGCAATTAGCTCCCTCCTCC | |
: AGAGACTCCAACTATGCCATG | |
: 121 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |