Gene/Protein Characteristic Table for KIAA1118

Length: 4522 bp

Restriction map

The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.

Length of 3'UTR	173 bp
Genome contig ID	gi51511734r_76677991
PolyA signal sequence (AGTAAA,-24)	+----*----+----*----+----*----+---- TGCATTTTAACAGTAAAGGAGGCCGTTGTTTTCAG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* CGCCTTGAGTGACTGCCTTGTCTTCTCTCCTGGGCTAGAGGCTGCCCAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	76777991	76811394	26	99.7	Perfect prediction

Length: 1165 aa

This protein sequence is predicted from the revised DNA sequence

Entry Exp ID% Protein Source Q9UPN4 0 100.0 5-azacytidine-i... Homo sapiens AAI36581 0 99.7 5-azacytidine i... Homo sapiens AAI36579 0 99.5 5-azacytidine i... Homo sapiens NP_055799 0 99.4 5-azacytidine i... Homo sapiens XP_001111529 0 93.2 similar to 5-az... Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB037819 0.00017 21.1 KIAA1398 AB037740 0.00092 27.7 KIAA1319

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	351	371	PF00612	IQ calmodulin-binding region

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-