HUGE

Gene/Protein Characteristic Table for KIAA1561

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01631
Accession No. :	AB046781
Description :	Uveal autoantigen with coiled-coil domains and ankyrin repeats.
HUGO Gene Name :	uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA)
Clone Name :	fh20178s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1561
Source :	Human fetal brain
Note :	We replaced fh20178, former representative clones for KIAA1561 with fh20178s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4373 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 122 bp

Genome contig ID gi51511731r_68636327
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TGCTGGTATAATTAAAATAAAATATATTTTGTTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTGGTAGGTTTTTTTTTAAAATTAGATGAATATGTTAGTCTTTTTCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 68736327 68842800 19 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI43267	99.9	Uveal autoantig...	Homo sapiens
AAG49577	99.7	uveal autoantig...	Homo sapiens
XP_001174957	99.3	uveal autoantig...	Pan troglodytes
AAG49576	99.7	uveal autoantig...	Bos taurus
XP_001088091	98.2	similar to uvea...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037755	9.6e-22	27.2	KIAA1334
AB075861	2.7e-15	30.1	KIAA1981
AB028997	5.2e-07	22.0	KIAA1074
D13629	4.3e-06	22.5	KIAA0004
AB002371	5e-06	21.9	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 101 113 PR01415 Ankyrin

IPR002110 179 191 PR01415 Ankyrin

HMMPfam IPR002110 38 66 PF00023 Ankyrin

IPR002110 67 99 PF00023 Ankyrin

IPR002110 100 132 PF00023 Ankyrin

IPR002110 133 165 PF00023 Ankyrin

IPR002110 166 198 PF00023 Ankyrin

IPR002110 199 231 PF00023 Ankyrin

IPR007596 811 833 PF04508 Viral A-type inclusion protein repeat

HMMSmart IPR002110 33 63 SM00248 Ankyrin

IPR002110 67 96 SM00248 Ankyrin

IPR002110 100 129 SM00248 Ankyrin

IPR002110 133 162 SM00248 Ankyrin

IPR002110 166 195 SM00248 Ankyrin

IPR002110 199 228 SM00248 Ankyrin

ProfileScan IPR002110 38 264 PS50297 Ankyrin

IPR002110 67 99 PS50088 Ankyrin

IPR002110 100 132 PS50088 Ankyrin

IPR002110 133 165 PS50088 Ankyrin

IPR002110 166 198 PS50088 Ankyrin

IPR002110 199 231 PS50088 Ankyrin

IPR000727 1318 1380 PS50192 Target SNARE coiled-coil region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	101	113	PR01415	Ankyrin
IPR002110	179	191	PR01415	Ankyrin
HMMPfam	IPR002110	38	66	PF00023	Ankyrin
IPR002110	67	99	PF00023	Ankyrin
IPR002110	100	132	PF00023	Ankyrin
IPR002110	133	165	PF00023	Ankyrin
IPR002110	166	198	PF00023	Ankyrin
IPR002110	199	231	PF00023	Ankyrin
IPR007596	811	833	PF04508	Viral A-type inclusion protein repeat
HMMSmart	IPR002110	33	63	SM00248	Ankyrin
IPR002110	67	96	SM00248	Ankyrin
IPR002110	100	129	SM00248	Ankyrin
IPR002110	133	162	SM00248	Ankyrin
IPR002110	166	195	SM00248	Ankyrin
IPR002110	199	228	SM00248	Ankyrin
ProfileScan	IPR002110	38	264	PS50297	Ankyrin
IPR002110	67	99	PS50088	Ankyrin
IPR002110	100	132	PS50088	Ankyrin
IPR002110	133	165	PS50088	Ankyrin
IPR002110	166	198	PS50088	Ankyrin
IPR002110	199	231	PS50088	Ankyrin
IPR000727	1318	1380	PS50192	Target SNARE coiled-coil region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATGCCGAAATTAAAGCCCAG

Primer_r
: TGTCTGCTCTGATAACTGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	122 bp
Genome contig ID	gi51511731r_68636327
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TGCTGGTATAATTAAAATAAAATATATTTTGTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGGTAGGTTTTTTTTTAAAATTAGATGAATATGTTAGTCTTTTTCAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	68736327	68842800	19	99.3	Perfect prediction

Primer_f	: CATGCCGAAATTAAAGCCCAG
Primer_r	: TGTCTGCTCTGATAACTGGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1561

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information