HUGE

Gene/Protein Characteristic Table for KIAA1981

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB075861
Description :	ankyrin repeat domain 24.
HUGO Gene Name :	ankyrin repeat domain 24 (ANKRD24)
Clone Name :	fk03148 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3366 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi42406306f_4049484
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGGCCACGGGGGAGCAGCAGCGCACGGCGGCCGC
Flanking genome sequence
(119290 - 119339)
----+----*----+----*----+----*----+----*----+----*
GGAACTGGGCCGGGCACGGGACGCCGCTGAGGCCCGAGTGGCTGAGCTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 4149434 4168772 16 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 862 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW69250	0	99.6	hCG1811453, iso...	Homo sapiens
Q8TF21	0	99.5	Ankyrin repeat ...	Homo sapiens
XP_609033	6.2e-140	75.9	similar to anky...	Bos taurus
EDL31384	2.9e-128	58.8	ankyrin repeat ...	Mus musculus
Q80VM7	9.3e-128	59.8	Ankyrin repeat ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037755	8e-21	29.0	KIAA1334
AB046781	3.2e-19	29.8	KIAA1561
AB033049	0.00012	30.3	KIAA1223
AB002377	0.00053	32.9	KIAA0379
AB014597	0.0008	24.6	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 106 118 PR01415 Ankyrin

IPR002110 184 196 PR01415 Ankyrin

HMMPfam IPR002110 72 104 PF00023 Ankyrin

IPR002110 105 137 PF00023 Ankyrin

IPR002110 138 170 PF00023 Ankyrin

IPR002110 171 203 PF00023 Ankyrin

IPR002110 204 236 PF00023 Ankyrin

HMMSmart IPR002110 72 101 SM00248 Ankyrin

IPR002110 105 134 SM00248 Ankyrin

IPR002110 138 169 SM00248 Ankyrin

IPR002110 171 200 SM00248 Ankyrin

IPR002110 204 233 SM00248 Ankyrin

ProfileScan IPR002110 38 257 PS50297 Ankyrin

IPR002110 72 104 PS50088 Ankyrin

IPR002110 105 137 PS50088 Ankyrin

IPR002110 171 203 PS50088 Ankyrin

IPR002110 204 236 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	106	118	PR01415	Ankyrin
IPR002110	184	196	PR01415	Ankyrin
HMMPfam	IPR002110	72	104	PF00023	Ankyrin
IPR002110	105	137	PF00023	Ankyrin
IPR002110	138	170	PF00023	Ankyrin
IPR002110	171	203	PF00023	Ankyrin
IPR002110	204	236	PF00023	Ankyrin
HMMSmart	IPR002110	72	101	SM00248	Ankyrin
IPR002110	105	134	SM00248	Ankyrin
IPR002110	138	169	SM00248	Ankyrin
IPR002110	171	200	SM00248	Ankyrin
IPR002110	204	233	SM00248	Ankyrin
ProfileScan	IPR002110	38	257	PS50297	Ankyrin
IPR002110	72	104	PS50088	Ankyrin
IPR002110	105	137	PS50088	Ankyrin
IPR002110	171	203	PS50088	Ankyrin
IPR002110	204	236	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTATAGCAGCTCAGATGTGTC

Primer_r
: AAGGTGCAGGATGAGTTTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	0 bp
Genome contig ID	gi42406306f_4049484
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGGCCACGGGGGAGCAGCAGCGCACGGCGGCCGC
Flanking genome sequence (119290 - 119339)	----+--------+--------+--------+--------+----* GGAACTGGGCCGGGCACGGGACGCCGCTGAGGCCCGAGTGGCTGAGCTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	4149434	4168772	16	99.4	Perfect prediction

Primer_f	: TTATAGCAGCTCAGATGTGTC
Primer_r	: AAGGTGCAGGATGAGTTTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1981

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information