HUGE

Gene/Protein Characteristic Table for KIAA1074

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00731
Accession No. :	AB028997
Description :	Ankyrin repeat domain-containing protein 26.
HUGO Gene Name :	ankyrin repeat domain 26 (ANKRD26)
Clone Name :	hj06637 [Vector Info]
Flexi ORF Clone :	pF1KSDA1074
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5360 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 80 bp

Genome contig ID gi89161187r_27234445
PolyA signal sequence
(ATTAAA,-33)
+----*----+----*----+----*----+----
TCATTAAATATTAATATATGACATGTAAAAATATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGGAACGTATTTTTGTATCATATATGTCAGATCAAAATTTATATAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 27334445 27429411 34 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09959	100.0	ankyrin repeat ...	synthetic construct
Q9UPS8	99.9	Ankyrin repeat ...	Homo sapiens
EAW86073	99.9	ankyrin repeat ...	Homo sapiens
CAC19649	99.9	novel protein [...	Homo sapiens
XP_507708	98.9	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011137	1.2e-37	50.5	KIAA0565
AB046861	7.2e-13	46.3	KIAA1641
AB095935	8.4e-13	42.5	KIAA2015
AB046781	4.5e-07	22.2	KIAA1561
AB037755	1.9e-06	21.8	KIAA1334

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 86 98 PR01415 Ankyrin

IPR002110 131 143 PR01415 Ankyrin

HMMPfam IPR002110 85 117 PF00023 Ankyrin

IPR002110 118 150 PF00023 Ankyrin

IPR002110 151 183 PF00023 Ankyrin

IPR002110 184 216 PF00023 Ankyrin

HMMSmart IPR002110 85 114 SM00248 Ankyrin

IPR002110 118 147 SM00248 Ankyrin

IPR002110 151 180 SM00248 Ankyrin

IPR002110 184 213 SM00248 Ankyrin

ProfileScan IPR002110 51 216 PS50297 Ankyrin

IPR002110 85 117 PS50088 Ankyrin

IPR002110 118 150 PS50088 Ankyrin

IPR002110 151 183 PS50088 Ankyrin

IPR002110 184 216 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	86	98	PR01415	Ankyrin
IPR002110	131	143	PR01415	Ankyrin
HMMPfam	IPR002110	85	117	PF00023	Ankyrin
IPR002110	118	150	PF00023	Ankyrin
IPR002110	151	183	PF00023	Ankyrin
IPR002110	184	216	PF00023	Ankyrin
HMMSmart	IPR002110	85	114	SM00248	Ankyrin
IPR002110	118	147	SM00248	Ankyrin
IPR002110	151	180	SM00248	Ankyrin
IPR002110	184	213	SM00248	Ankyrin
ProfileScan	IPR002110	51	216	PS50297	Ankyrin
IPR002110	85	117	PS50088	Ankyrin
IPR002110	118	150	PS50088	Ankyrin
IPR002110	151	183	PS50088	Ankyrin
IPR002110	184	216	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTCACCACTCTCACTACCAG

Primer_r
: TGCTCAAGTAGTTCTCCATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTTCACCACTCTCACTACCAG
Primer_r	: TGCTCAAGTAGTTCTCCATGC
PCR product length	: 161 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	80 bp
Genome contig ID	gi89161187r_27234445
PolyA signal sequence (ATTAAA,-33)	+--------+--------+----*----+---- TCATTAAATATTAATATATGACATGTAAAAATATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGAACGTATTTTTGTATCATATATGTCAGATCAAAATTTATATAGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	27334445	27429411	34	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1074

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information