Gene/Protein Characteristic Table for KIAA0565

Length: 5694 bp

Restriction map

The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.

Length of 3'UTR	2648 bp
Genome contig ID	gi51511734f_16475256
PolyA signal sequence (None)	+----*----+----*----+----*----+---- ACTGCAGCCCAGGTGACAGAGCAAGACTCCATCTC
Flanking genome sequence (135524 - 135573)	----+----*----+----*----+----*----+----*----+----* ATGGGTGGGGGAAAAAAAATAAATAAAATAAATAAAAGCAGATGTGATGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	16575256	16610778	6	98.9	Perfect prediction
ContigView(URL based/DAS)	17	r	18392984	18428136	6	97.7	Perfect prediction
ContigView(URL based/DAS)	17	f	20205515	20240703	6	97.5	Perfect prediction

Length: 641 aa

This protein sequence is predicted from the revised DNA sequence

Entry Exp ID% Protein Source A2RUR9 4.2e-174 98.4 Coiled-coil dom... Homo sapiens AAI44226 1.1e-173 98.3 Unknown (protei... Homo sapiens Q8IYA2 2.1e-150 94.9 Coiled-coil dom... Homo sapiens XP_001103275 1.2e-148 85.9 similar to Myos... Macaca mulatta XP_001103196 1.5e-101 80.0 similar to anky... Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB028997 2.8e-42 50.5 KIAA1074 AB095935 4e-15 31.8 KIAA2015 AB046861 3.6e-14 41.8 KIAA1641 AB020673 8.4e-05 22.7 KIAA0866

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-