HUGE |
Gene/Protein Characteristic Table for KIAA0565 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB011137 |
Description : | |
HUGO Gene Name : | coiled-coil domain containing 144A (CCDC144A) |
Clone Name : | hh01904 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5694 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | ||
Warning for N-terminal truncation: | NO | NO |
Warning for coding interruption: | YES | NO |
Length of 3'UTR 2648 bp Genome contig ID gi51511734f_16475256 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACTGCAGCCCAGGTGACAGAGCAAGACTCCATCTCFlanking genome sequence
(135524 - 135573) ----+----*----+----*----+----*----+----*----+----*
ATGGGTGGGGGAAAAAAAATAAATAAAATAAATAAAAGCAGATGTGATGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 16575256 16610778 6 98.9 Perfect prediction ContigView(URL based/DAS) 17 r 18392984 18428136 6 97.7 Perfect prediction ContigView(URL based/DAS) 17 f 20205515 20240703 6 97.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 641 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GCCTACATCTGCTTTTTATAC | |
: TCCTTTCACAGTACTTACCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: GCCTACATCTGCTTTTTATAC | |
: TCCTTTCACAGTACTTACCAG | |
: 85 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |