HUGE

Gene/Protein Characteristic Table for KIAA1641

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04112
Accession No. :	AB046861
Description :	Ankyrin repeat domain-containing protein 36B.
HUGO Gene Name :
Clone Name :	fj10609s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj10609, former representative clones for KIAA1641 with fj10609s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2924 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 103 bp

Genome contig ID gi89161199f_97142191
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
ATAATTAATGTTATTAAAATTTTATAGTGGATGGC
Flanking genome sequence
(135039 - 135088)
----+----*----+----*----+----*----+----*----+----*
TTTCTTCTGTATTTTCCTTATTATTAATTTTATTAAGATTTTATTATAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 97242191 97277228 14 99.1 Perfect prediction

ContigView(URL based/DAS) 2 r 97492331 97527572 14 98.8 Perfect prediction

ContigView(URL based/DAS) 2 r 95883039 95918285 14 97.6 Perfect prediction

Features of the protein sequence	Description

Length: 718 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI46836	0	100.0	ANKRD36B protei...	Homo sapiens
Q8N2N9	2.1e-212	94.4	UPF0634 protein...	Homo sapiens
NP_079466	1.2e-211	94.1	ankyrin repeat ...	Homo sapiens
XP_001714737	2e-207	92.3	protein immuno-...	Homo sapiens
Q5JPF3	3.8e-207	92.2	UPF0634 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028997	4.4e-17	46.3	KIAA1074
AB011137	1.3e-16	41.8	KIAA0565
AB095935	2.5e-15	32.8	KIAA2015

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCAGATGTGATGCTAGAGTAC

Primer_r
: CGTTTTTGTTGAAGCTGTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: CCAGATGTGATGCTAGAGTAC
Primer_r	: CGTTTTTGTTGAAGCTGTCTC
PCR product length	: 178(1.6k) bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	103 bp
Genome contig ID	gi89161199f_97142191
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATAATTAATGTTATTAAAATTTTATAGTGGATGGC
Flanking genome sequence (135039 - 135088)	----+--------+--------+--------+--------+----* TTTCTTCTGTATTTTCCTTATTATTAATTTTATTAAGATTTTATTATAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	97242191	97277228	14	99.1	Perfect prediction
ContigView(URL based/DAS)	2	r	97492331	97527572	14	98.8	Perfect prediction
ContigView(URL based/DAS)	2	r	95883039	95918285	14	97.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1641

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information