HUGE

Gene/Protein Characteristic Table for KIAA0568

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06451
Accession No. :	AB011140
Description :	Periplakin.
HUGO Gene Name :
Clone Name :	hh02280 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5143 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1426 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI14621	100.0	Periplakin [Hom...	Homo sapiens
O60437	99.9	Periplakin; 195...	Homo sapiens
NP_002696	99.9	periplakin [Hom...	Homo sapiens
AAC39668	99.8	periplakin [Hom...	Homo sapiens
AAC17738	99.8	195 kDa cornifi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	8.2e-07	23.2	KIAA0866
D13629	1.3e-05	21.1	KIAA0004
AB037740	0.00014	23.7	KIAA1319
AB023217	0.00019	21.3	KIAA1000
AB029004	0.0004	22.5	KIAA1081

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001101 1330 1362 PF00681 Plectin repeat

HMMSmart IPR001101 1321 1355 SM00250 Plectin repeat

IPR001101 1370 1405 SM00250 Plectin repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001101	1330	1362	PF00681	Plectin repeat
HMMSmart	IPR001101	1321	1355	SM00250	Plectin repeat
IPR001101	1370	1405	SM00250	Plectin repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACTGAAGGACAAGCCAACCAC

Primer_r
: ATTCTCTGTAGGTGCCGGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTGAAGGACAAGCCAACCAC
Primer_r	: ATTCTCTGTAGGTGCCGGGAC
PCR product length	: 312 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0568

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information