HUGE |
Gene/Protein Characteristic Table for KIAA0598 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01101 |
---|---|
Accession No. : | AB011170 |
Description : | N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase. |
HUGO Gene Name : | |
Clone Name : | hj03045 [Vector Info] |
Flexi ORF Clone : | pF1KA0598 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4712 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2445 bp Genome contig ID gi89161187r_125657210 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
TATTTAACATAATTAAAGATGGACCCATAAGAGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACGCCTGTGGAGCGCGTGCTCTTCCTCTGCAGCCAAGCTCTTCCTGGTGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 125757210 125841898 8 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 614 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AAAGGGTTGTGTCCAGAGCGG | |
: CGTGTGGGTGAGTGCGTCTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 10 |
: GeneBridge 4 | |
: AAAGGGTTGTGTCCAGAGCGG | |
: CGTGTGGGTGAGTGCGTCTTC | |
: 77 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |