HUGE

Gene/Protein Characteristic Table for KIAA0612

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01985
Accession No. :	AB014512
Description :	Peripheral-type benzodiazepine receptor-associated protein 1.
HUGO Gene Name :	benzodiazapine receptor (peripheral) associated protein 1 (BZRAP1)
Clone Name :	hg00654s1 [Vector Info]
Flexi ORF Clone :	pF1KA0612
Source :	Human adult brain
Note :	We replaced hg00654, former representative clones for KIAA0612 with hg00654s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 7479 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1245 bp

Genome contig ID gi51511734r_53633595
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAAAGACATTTTATTATAATAAAGTCTATTTTCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATCTATGCTGGACTCTCCATGGGCAAAGGACTCCTTGGAGGGGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 53733595 53761120 31 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1810 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50280	100.0	BZRAP1 protein ...	Homo sapiens
EAW94469	99.8	benzodiazapine ...	Homo sapiens
NP_077729	99.7	peripheral benz...	Homo sapiens
EAW94468	96.6	benzodiazapine ...	Homo sapiens
O95153	96.5	Peripheral-type...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051453	5.7e-10	30.0	KIAA1666
AB002316	1.3e-05	32.6	KIAA0318

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 609 669 PD000066 Src homology-3

IPR001452 1583 1642 PD000066 Src homology-3

IPR001452 1723 1780 PD000066 Src homology-3

FPrintScan IPR001452 1581 1591 PR00452 Src homology-3

IPR001452 1603 1618 PR00452 Src homology-3

IPR001452 1632 1644 PR00452 Src homology-3

HMMPfam IPR011511 620 671 PF07653 Variant SH3

IPR011511 1582 1644 PF07653 Variant SH3

IPR011511 1721 1781 PF07653 Variant SH3

HMMSmart IPR001452 609 672 SM00326 Src homology-3

IPR003961 744 821 SM00060 Fibronectin

IPR003961 835 908 SM00060 Fibronectin

IPR003961 932 1019 SM00060 Fibronectin

IPR001452 1581 1645 SM00326 Src homology-3

IPR001452 1720 1783 SM00326 Src homology-3

ProfileScan IPR001452 606 673 PS50002 Src homology-3

IPR003961 741 830 PS50853 Fibronectin

IPR003961 834 917 PS50853 Fibronectin

IPR003961 931 1029 PS50853 Fibronectin

IPR001452 1578 1646 PS50002 Src homology-3

IPR001452 1717 1784 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	609	669	PD000066	Src homology-3
IPR001452	1583	1642	PD000066	Src homology-3
IPR001452	1723	1780	PD000066	Src homology-3
FPrintScan	IPR001452	1581	1591	PR00452	Src homology-3
IPR001452	1603	1618	PR00452	Src homology-3
IPR001452	1632	1644	PR00452	Src homology-3
HMMPfam	IPR011511	620	671	PF07653	Variant SH3
IPR011511	1582	1644	PF07653	Variant SH3
IPR011511	1721	1781	PF07653	Variant SH3
HMMSmart	IPR001452	609	672	SM00326	Src homology-3
IPR003961	744	821	SM00060	Fibronectin
IPR003961	835	908	SM00060	Fibronectin
IPR003961	932	1019	SM00060	Fibronectin
IPR001452	1581	1645	SM00326	Src homology-3
IPR001452	1720	1783	SM00326	Src homology-3
ProfileScan	IPR001452	606	673	PS50002	Src homology-3
IPR003961	741	830	PS50853	Fibronectin
IPR003961	834	917	PS50853	Fibronectin
IPR003961	931	1029	PS50853	Fibronectin
IPR001452	1578	1646	PS50002	Src homology-3
IPR001452	1717	1784	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCAGTGCCTCAGTTCAGCTTC

Primer_r
: AATAAGGCAAACCCAACTCCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGGTCAAGGTGGGGGTTCAG
Primer_r	: TTCAGAGTGGGGTAGGGGTTC
PCR product length	: 133 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1245 bp
Genome contig ID	gi51511734r_53633595
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAAAGACATTTTATTATAATAAAGTCTATTTTCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCTATGCTGGACTCTCCATGGGCAAAGGACTCCTTGGAGGGGTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	53733595	53761120	31	99.7	Perfect prediction

Primer_f	: TCAGTGCCTCAGTTCAGCTTC
Primer_r	: AATAAGGCAAACCCAACTCCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0612

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information