HUGE |
Gene/Protein Characteristic Table for KIAA1666 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05699 |
---|---|
Accession No. : | AB051453 |
Description : | |
HUGO Gene Name : | RIMS binding protein 3 (RIMBP3) |
Clone Name : | fg02554 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5477 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 700 bp Genome contig ID gi89161203f_19968293 PolyA signal sequence
(ATTAAA,-16) +----*----+----*----+----*----+----
GTCTTATGTCCAACCCCTCATTAAAATGTTCATAGFlanking genome sequence
(105476 - 105525) ----+----*----+----*----+----*----+----*----+----*
AAAAAACATATTTTAGAAGTTGAAGCACAACCAAGGAAACATGAGCCTGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 18835682 18841156 1 99.0 Perfect prediction ContigView(URL based/DAS) 22 f 20068293 20073767 1 99.0 Perfect prediction ContigView(URL based/DAS) 22 r 20229646 20235120 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1003 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |