HUGE

Gene/Protein Characteristic Table for KIAA1666

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05699
Accession No. :	AB051453
Description :
HUGO Gene Name :	RIMS binding protein 3 (RIMBP3)
Clone Name :	fg02554 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5477 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 700 bp

Genome contig ID gi89161203f_19968293
PolyA signal sequence
(ATTAAA,-16)
+----*----+----*----+----*----+----
GTCTTATGTCCAACCCCTCATTAAAATGTTCATAG
Flanking genome sequence
(105476 - 105525)
----+----*----+----*----+----*----+----*----+----*
AAAAAACATATTTTAGAAGTTGAAGCACAACCAAGGAAACATGAGCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 18835682 18841156 1 99.0 Perfect prediction

ContigView(URL based/DAS) 22 f 20068293 20073767 1 99.0 Perfect prediction

ContigView(URL based/DAS) 22 r 20229646 20235120 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1003 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAB61362	98.9	hypothetical pr...	Homo sapiens
Q9UFD9	98.9	RIMS-binding pr...	Homo sapiens
AAI67855	98.9	RIMS binding pr...	synthetic construct
A6NNM3	98.4	RIMS-binding pr...	Homo sapiens
A6NJZ7	98.4	RIMS-binding pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014512	5.2e-19	30.2	KIAA0612
AB002316	1.7e-09	28.6	KIAA0318

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 199 259 PD000066 Src homology-3

IPR001452 820 880 PD000066 Src homology-3

IPR001452 939 996 PD000066 Src homology-3

FPrintScan IPR001452 199 209 PR00452 Src homology-3

IPR001452 219 234 PR00452 Src homology-3

IPR001452 249 261 PR00452 Src homology-3

HMMPfam IPR011511 200 261 PF07653 Variant SH3

IPR011511 820 882 PF07653 Variant SH3

IPR011511 937 998 PF07653 Variant SH3

HMMSmart IPR001452 199 262 SM00326 Src homology-3

IPR001452 819 883 SM00326 Src homology-3

IPR001452 936 999 SM00326 Src homology-3

ProfileScan IPR001452 196 263 PS50002 Src homology-3

IPR001452 933 1000 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	199	259	PD000066	Src homology-3
IPR001452	820	880	PD000066	Src homology-3
IPR001452	939	996	PD000066	Src homology-3
FPrintScan	IPR001452	199	209	PR00452	Src homology-3
IPR001452	219	234	PR00452	Src homology-3
IPR001452	249	261	PR00452	Src homology-3
HMMPfam	IPR011511	200	261	PF07653	Variant SH3
IPR011511	820	882	PF07653	Variant SH3
IPR011511	937	998	PF07653	Variant SH3
HMMSmart	IPR001452	199	262	SM00326	Src homology-3
IPR001452	819	883	SM00326	Src homology-3
IPR001452	936	999	SM00326	Src homology-3
ProfileScan	IPR001452	196	263	PS50002	Src homology-3
IPR001452	933	1000	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	700 bp
Genome contig ID	gi89161203f_19968293
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- GTCTTATGTCCAACCCCTCATTAAAATGTTCATAG
Flanking genome sequence (105476 - 105525)	----+--------+--------+--------+--------+----* AAAAAACATATTTTAGAAGTTGAAGCACAACCAAGGAAACATGAGCCTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	18835682	18841156	1	99.0	Perfect prediction
ContigView(URL based/DAS)	22	f	20068293	20073767	1	99.0	Perfect prediction
ContigView(URL based/DAS)	22	r	20229646	20235120	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1666

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information