HUGE

Gene/Protein Characteristic Table for KIAA0617

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00577
Accession No. :	AB014517
Description :	Cullin-3.
HUGO Gene Name :
Clone Name :	hg03834 [Vector Info]
Flexi ORF Clone :	pF1KSDA0617
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6716 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4093 bp

Genome contig ID gi89161199r_224943113
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TTGCAATGTGGGAAAATTAAAATTCTCAGTCTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTCTTTCTGCAGTTGTGATTCTTGAATAAATGCCTCAGCACGATGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 225043113 225158290 16 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 786 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13618	100.0	Cullin-3; Short...	Homo sapiens
XP_614056	99.7	similar to Cull...	Bos taurus
XP_422620	99.6	similar to cull...	Gallus gallus
Q9JLV5	99.5	Cullin-3; Short...	Mus musculus
EAW70829	99.7	cullin 3, isofo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014595	1.9e-52	38.2	KIAA0695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001373 52 684 PF00888 Cullin

HMMSmart IPR001373 431 581 SM00182 Cullin

ProfileScan IPR001373 401 653 PS50069 Cullin

ScanRegExp IPR001373 759 786 PS01256 Cullin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	52	684	PF00888	Cullin
HMMSmart	IPR001373	431	581	SM00182	Cullin
ProfileScan	IPR001373	401	653	PS50069	Cullin
ScanRegExp	IPR001373	759	786	PS01256	Cullin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCCAAGATGCTGATGATAGG

Primer_r
: AAACCTAAGATGATGCCAGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCCAAGATGCTGATGATAGG
Primer_r	: AAACCTAAGATGATGCCAGTG
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4093 bp
Genome contig ID	gi89161199r_224943113
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TTGCAATGTGGGAAAATTAAAATTCTCAGTCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCTTTCTGCAGTTGTGATTCTTGAATAAATGCCTCAGCACGATGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	225043113	225158290	16	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0617

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information