HUGE

Gene/Protein Characteristic Table for KIAA0695

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04683
Accession No. :	AB014595
Description :	Cullin-4B.
HUGO Gene Name :
Clone Name :	hk04006s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk04006, former representative clones for KIAA0695 with hk04006s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4490 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2144 bp

Genome contig ID gi89161218r_119442502
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
GGTGGTTCTATTTTTCTCCAATAAAACTTTTATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGTTTCTAGAGAAGATCTTTAAAATTCAAGTATTGTAAGAAAGT

Features of the protein sequence	Description

Length: 781 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13620	100.0	Cullin-4B; Shor...	Homo sapiens
EAX11880	100.0	cullin 4B, isof...	Homo sapiens
CAI41370	100.0	cullin 4B [Homo...	Homo sapiens
XP_001086195	100.0	cullin 4B isofo...	Macaca mulatta
AAR13073	99.9	cullin 4B [Homo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014517	2.1e-44	38.2	KIAA0617
AB037827	9.8e-07	27.8	KIAA1406

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001373 85 683 PF00888 Cullin

HMMSmart IPR001373 456 604 SM00182 Cullin

ProfileScan IPR001373 426 654 PS50069 Cullin

ScanRegExp IPR001373 754 781 PS01256 Cullin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	85	683	PF00888	Cullin
HMMSmart	IPR001373	456	604	SM00182	Cullin
ProfileScan	IPR001373	426	654	PS50069	Cullin
ScanRegExp	IPR001373	754	781	PS01256	Cullin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACCGGACCATCAACAACAGTG

Primer_r
: GGACCCGCTTTCAAGATACTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCGGACCATCAACAACAGTG
Primer_r	: GGACCCGCTTTCAAGATACTG
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2144 bp
Genome contig ID	gi89161218r_119442502
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GGTGGTTCTATTTTTCTCCAATAAAACTTTTATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGTTTCTAGAGAAGATCTTTAAAATTCAAGTATTGTAAGAAAGT

Gene/Protein Characteristic Table for KIAA0695

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information