HUGE

Gene/Protein Characteristic Table for KIAA1406

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04099
Accession No. :	AB037827
Description :	Anaphase-promoting complex subunit 2.
HUGO Gene Name :	anaphase promoting complex subunit 2 (ANAPC2)
Clone Name :	fg03519s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fg03519, former representative clones for KIAA1406 with fg03519s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 1876 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 158 bp

Genome contig ID gi89161216r_139089057
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
CCCGCAGTGTGCAGATTAAAGCAAGTCAGATCATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTTTCTGTCCTGGTGGCTTTGTGGGGCCCCCCAGGATCCTCCTCTAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 139189057 139200618 11 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UJX6	100.0	Anaphase-promot...	Homo sapiens
XP_001089959	99.5	anaphase-promot...	Macaca mulatta
AAH01579	99.5	ANAPC2 protein ...	Homo sapiens
XP_548357	97.2	similar to Anap...	Canis lupus fam...
EDL93618	96.8	anaphase promot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014595	1.1e-08	28.0	KIAA0695

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001373 70 484 PF00888 Cullin

IPR014786 506 566 PF08672 Anaphase promoting complex subunit 2

HMMSmart IPR001373 249 397 SM00182 Cullin

ProfileScan IPR001373 251 449 PS50069 Cullin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001373	70	484	PF00888	Cullin
IPR014786	506	566	PF08672	Anaphase promoting complex subunit 2
HMMSmart	IPR001373	249	397	SM00182	Cullin
ProfileScan	IPR001373	251	449	PS50069	Cullin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGCTGCTCTTCTGGACGTAC

Primer_r
: GTCACCACAAACATGCGGAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGCTGCTCTTCTGGACGTAC
Primer_r	: GTCACCACAAACATGCGGAGC
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	158 bp
Genome contig ID	gi89161216r_139089057
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- CCCGCAGTGTGCAGATTAAAGCAAGTCAGATCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTTTTCTGTCCTGGTGGCTTTGTGGGGCCCCCCAGGATCCTCCTCTAGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	139189057	139200618	11	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1406

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information