HUGE |
Gene/Protein Characteristic Table for KIAA1406 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04099 |
---|---|
Accession No. : | AB037827 |
Description : | Anaphase-promoting complex subunit 2. |
HUGO Gene Name : | anaphase promoting complex subunit 2 (ANAPC2) |
Clone Name : | fg03519s1 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fg03519, former representative clones for KIAA1406 with fg03519s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1876 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 158 bp Genome contig ID gi89161216r_139089057 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
CCCGCAGTGTGCAGATTAAAGCAAGTCAGATCATCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CTTTTCTGTCCTGGTGGCTTTGTGGGGCCCCCCAGGATCCTCCTCTAGCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 139189057 139200618 11 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 571 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTGCTGCTCTTCTGGACGTAC | |
: GTCACCACAAACATGCGGAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: CTGCTGCTCTTCTGGACGTAC | |
: GTCACCACAAACATGCGGAGC | |
: 98 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |