HUGE

Gene/Protein Characteristic Table for KIAA0624

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04929
Accession No. :	AB014524
Description :	Slp homolog lacking C2 domains b.
HUGO Gene Name :
Clone Name :	hg04767 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6542 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NEV8	99.9	Exophilin-5; Sy...	Homo sapiens
AAM44402	99.9	exophilin 5 [Ho...	Homo sapiens
NP_055880	99.8	exophilin 5 iso...	Homo sapiens
AAI17702	99.8	Exophilin 5 [Ho...	Homo sapiens
XP_001141449	98.6	exophilin 5 iso...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	3.2e-05	20.1	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR010911 1 57 PS50916 Rab-binding

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR010911	1	57	PS50916	Rab-binding

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACTGTCTGATTTGGGCTTTC

Primer_r
: TTACCCCACTGTTATCATCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACTGTCTGATTTGGGCTTTC
Primer_r	: TTACCCCACTGTTATCATCCC
PCR product length	: 201 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0624

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information