HUGE

Gene/Protein Characteristic Table for KIAA0629

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04072
Accession No. :	AB014529
Description :	A-kinase anchor protein 11.
HUGO Gene Name :	A kinase (PRKA) anchor protein 11 (AKAP11)
Clone Name :	pf00524 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced hh01672, former representative clones for KIAA0629 with pf00524. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7855 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4034 bp

Genome contig ID gi51511729f_41672768
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTAAGAGTTCTTCAATAAATTTAAGAAATACCTGG
Flanking genome sequence
(122636 - 122685)
----+----*----+----*----+----*----+----*----+----*
TCTTGGTTTTCATTCTATAATATCTCATTAACTGCTCTGTACTGAGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 41772768 41795402 6 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1272 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKA4	100.0	A-kinase anchor...	Homo sapiens
XP_001151723	98.5	A-kinase anchor...	Pan troglodytes
XP_001091086	94.2	A-kinase anchor...	Macaca mulatta
XP_001151787	96.3	A-kinase anchor...	Pan troglodytes
XP_001492688	81.1	similar to A-ki...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051465	1.7e-07	23.1	KIAA1678

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008382 1196 1272 PF05716 A-kinase anchor 110 kDa

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008382	1196	1272	PF05716	A-kinase anchor 110 kDa

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAAACCCTGTCCACCTGTCAC

Primer_r
: AGGAGTCTTGCTGAAAATGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAAACCCTGTCCACCTGTCAC
Primer_r	: AGGAGTCTTGCTGAAAATGAG
PCR product length	: 109 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4034 bp
Genome contig ID	gi51511729f_41672768
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTAAGAGTTCTTCAATAAATTTAAGAAATACCTGG
Flanking genome sequence (122636 - 122685)	----+--------+--------+--------+--------+----* TCTTGGTTTTCATTCTATAATATCTCATTAACTGCTCTGTACTGAGTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	41772768	41795402	6	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0629

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information