HUGE

Gene/Protein Characteristic Table for KIAA0630

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05422
Accession No. :	AB014530
Description :	Homeodomain-interacting protein kinase 1.
HUGO Gene Name :	homeodomain interacting protein kinase 1 (HIPK1)
Clone Name :	hh01735 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5761 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4287 bp

Genome contig ID gi89161185f_114207585
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ATTGCAATGCATCAATAAAATGGGTAAATTTTCTG
Flanking genome sequence
(114361 - 114410)
----+----*----+----*----+----*----+----*----+----*
ACTTATGTGGCTGTTTTTGACTTCTGTTATAGGATATAAAGGGGATCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 114307585 114321944 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI22795	1.6e-160	99.8	homeodomain int...	Homo sapiens
AAH28408	1.7e-160	99.8	Homeodomain int...	Homo sapiens
Q86Z02	2.2e-160	99.8	Homeodomain-int...	Homo sapiens
BAG63945	2.3e-160	99.8	unnamed protein...	Homo sapiens
AAH36057	3e-160	99.6	Homeodomain int...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACAGCAATGATTCCAGAGG

Primer_r
: TGGTTAGTCAGCAAGGATGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCACAGCAATGATTCCAGAGG
Primer_r	: TGGTTAGTCAGCAAGGATGGC
PCR product length	: 121 (1.0k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4287 bp
Genome contig ID	gi89161185f_114207585
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATTGCAATGCATCAATAAAATGGGTAAATTTTCTG
Flanking genome sequence (114361 - 114410)	----+--------+--------+--------+--------+----* ACTTATGTGGCTGTTTTTGACTTCTGTTATAGGATATAAAGGGGATCAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	114307585	114321944	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0630

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information