HUGE

Gene/Protein Characteristic Table for KIAA0638

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00584
Accession No. :	AB014538
Description :	Pleckstrin homology-like domain family B member 1.
HUGO Gene Name :	pleckstrin homology-like domain, family B, member 1 (PHLDB1)
Clone Name :	hj03347s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0638
Source :	Human adult brain
Note :	We replaced hj03347, former representative clones for KIAA0638 with hj03347s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5449 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1208 bp

Genome contig ID gi51511727f_117883551
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CAGCAGAACAATAAAGCCTTTGGACTACGGAAGTG
Flanking genome sequence
(150402 - 150451)
----+----*----+----*----+----*----+----*----+----*
AGTGGAAGGCCGGTGTGGGGCTTGGCGCTGAGGCACTTGGGGATAGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 117983547 118033951 23 99.7 Terminal No-hit

Features of the protein sequence	Description

Length: 1384 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q86UU1	100.0	Pleckstrin homo...	Homo sapiens
XP_001162204	99.7	pleckstrin homo...	Pan troglodytes
EAW67404	99.3	pleckstrin homo...	Homo sapiens
XP_546499	95.7	similar to plec...	Canis lupus fam...
XP_001162611	98.9	pleckstrin homo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000253 71 132 PF00498 Forkhead-associated

IPR001849 1264 1377 PF00169 Pleckstrin-like

HMMSmart IPR001849 1264 1379 SM00233 Pleckstrin-like

ProfileScan IPR001849 1263 1377 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	71	132	PF00498	Forkhead-associated
IPR001849	1264	1377	PF00169	Pleckstrin-like
HMMSmart	IPR001849	1264	1379	SM00233	Pleckstrin-like
ProfileScan	IPR001849	1263	1377	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTAGAGCCAGAAGGGATGAAG

Primer_r
: ACAGAACTCCAACCATAACCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTAGAGCCAGAAGGGATGAAG
Primer_r	: ACAGAACTCCAACCATAACCC
PCR product length	: 97 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1208 bp
Genome contig ID	gi51511727f_117883551
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAGCAGAACAATAAAGCCTTTGGACTACGGAAGTG
Flanking genome sequence (150402 - 150451)	----+--------+--------+--------+--------+----* AGTGGAAGGCCGGTGTGGGGCTTGGCGCTGAGGCACTTGGGGATAGGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	117983547	118033951	23	99.7	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0638

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information