HUGE |
Gene/Protein Characteristic Table for KIAA0638 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00584 |
---|---|
Accession No. : | AB014538 |
Description : | Pleckstrin homology-like domain family B member 1. |
HUGO Gene Name : | pleckstrin homology-like domain, family B, member 1 (PHLDB1) |
Clone Name : | hj03347s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0638
![]() |
Source : | Human adult brain |
Note : | We replaced hj03347, former representative clones for KIAA0638 with hj03347s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5449 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1208 bp Genome contig ID gi51511727f_117883551 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
CAGCAGAACAATAAAGCCTTTGGACTACGGAAGTGFlanking genome sequence
(150402 - 150451) ----+----*----+----*----+----*----+----*----+----*
AGTGGAAGGCCGGTGTGGGGCTTGGCGCTGAGGCACTTGGGGATAGGTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 117983547 118033951 23 99.7 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1384 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TTAGAGCCAGAAGGGATGAAG | |
: ACAGAACTCCAACCATAACCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: TTAGAGCCAGAAGGGATGAAG | |
: ACAGAACTCCAACCATAACCC | |
: 97 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |