HUGE

Gene/Protein Characteristic Table for KIAA0643

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04588
Accession No. :	AB014543
Description :	Clusterin-associated protein 1.
HUGO Gene Name :	clusterin associated protein 1 (CLUAP1)
Clone Name :	hj03545 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5127 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3913 bp

Genome contig ID gi51511732f_3391019
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCACAATACCAAGCATTAAATGTATTTTAATAACT
Flanking genome sequence
(135809 - 135858)
----+----*----+----*----+----*----+----*----+----*
AAACTTTTCTGAAAGAAGGTTAGCTAAAGTTAAATGAAAACTTGGTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 3491019 3526826 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW85352	1.5e-129	100.0	clusterin assoc...	Homo sapiens
XP_001167227	6.3e-129	99.5	clusterin assoc...	Pan troglodytes
AAH17070	6.5e-121	100.0	Clusterin assoc...	Homo sapiens
Q96AJ1	6.5e-121	100.0	Clusterin-assoc...	Homo sapiens
XP_001167259	9.8e-121	98.4	clusterin assoc...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAAGAGCTGACGCCACACAAG

Primer_r
: CAGATGTTCCCCTACGATTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAAGAGCTGACGCCACACAAG
Primer_r	: CAGATGTTCCCCTACGATTCC
PCR product length	: 125 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3913 bp
Genome contig ID	gi51511732f_3391019
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TCACAATACCAAGCATTAAATGTATTTTAATAACT
Flanking genome sequence (135809 - 135858)	----+--------+--------+--------+--------+----* AAACTTTTCTGAAAGAAGGTTAGCTAAAGTTAAATGAAAACTTGGTTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	3491019	3526826	11	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0643

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information