HUGE

Gene/Protein Characteristic Table for KIAA0660

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00112
Accession No. :	AB014560
Description :	Ras GTPase-activating protein-binding protein 2.
HUGO Gene Name :	GTPase activating protein (SH3 domain) binding protein 2 (G3BP2)
Clone Name :	hk01902 [Vector Info]
Flexi ORF Clone :	pF1KA0660
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4210 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 490 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE26595	9.4e-146	98.4	unnamed protein...	Mus musculus
BAE31814	1.6e-145	98.2	unnamed protein...	Mus musculus
CAH91236	9.9e-145	99.8	hypothetical pr...	Pongo abelii
AAD51932	1.2e-144	99.8	RNA-binding pro...	Homo sapiens
XP_001100686	1.2e-144	99.8	similar to Ras-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002075 19 141 PF02136 Nuclear transport factor 2

IPR000504 341 397 PF00076 RNA recognition motif

HMMSmart IPR000504 340 413 SM00360 RNA recognition motif

ProfileScan IPR002075 19 141 PS50177 Nuclear transport factor 2

IPR000504 339 417 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002075	19	141	PF02136	Nuclear transport factor 2
IPR000504	341	397	PF00076	RNA recognition motif
HMMSmart	IPR000504	340	413	SM00360	RNA recognition motif
ProfileScan	IPR002075	19	141	PS50177	Nuclear transport factor 2
IPR000504	339	417	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCCCTGCCATCCATGAAAAC

Primer_r
: CTGAATGGCTCTTTGCTCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCCCTGCCATCCATGAAAAC
Primer_r	: CTGAATGGCTCTTTGCTCTAC
PCR product length	: 91 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0660

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information