HUGE

Gene/Protein Characteristic Table for KIAA0661

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01601
Accession No. :	AB014561
Description :	E3 ubiquitin-protein ligase BRE1B.
HUGO Gene Name :	ring finger protein 40 (RNF40)
Clone Name :	hk01952 [Vector Info]
Flexi ORF Clone :	pF1KSDA0661
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4199 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1030 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001102375	98.2	similar to ring...	Macaca mulatta
O75150	100.0	E3 ubiquitin-pr...	Homo sapiens
AAP36593	100.0	ring finger pro...	synthetic construct
CAH10518	99.9	hypothetical pr...	Homo sapiens
BAF84355	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029004	3.8e-05	22.3	KIAA1081
AB032993	0.00095	23.8	KIAA1167

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 977 1015 PF00097 Zinc finger

HMMSmart IPR001841 977 1015 SM00184 Zinc finger

ProfileScan IPR001841 977 1016 PS50089 Zinc finger

ScanRegExp IPR001841 992 1001 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	977	1015	PF00097	Zinc finger
HMMSmart	IPR001841	977	1015	SM00184	Zinc finger
ProfileScan	IPR001841	977	1016	PS50089	Zinc finger
ScanRegExp	IPR001841	992	1001	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCTAACCCTGCTTTCATCCTG

Primer_r
: GCTGGAATGATTGGAAGTTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTAACCCTGCTTTCATCCTG
Primer_r	: GCTGGAATGATTGGAAGTTGG
PCR product length	: 111 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0661

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information