HUGE

Gene/Protein Characteristic Table for KIAA0665

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00598
Accession No. :	AB014565
Description :	Rab11 family-interacting protein 3.
HUGO Gene Name :	RAB11 family interacting protein 3 (class II) (RAB11FIP3)
Clone Name :	hk02064 [Vector Info]
Flexi ORF Clone :	pF1KSDA0665
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4080 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75154	2.9e-193	100.0	Rab11 family-in...	Homo sapiens
XP_001118464	3.9e-152	92.4	rab11-family in...	Macaca mulatta
XP_001496965	2.8e-134	84.1	similar to Rab1...	Equus caballus
EAW85807	1.2e-107	99.8	RAB11 family in...	Homo sapiens
BAG64178	1.3e-107	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058724	6.5e-19	39.8	KIAA1821

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002048 210 238 PF00036 Calcium-binding EF-hand

ProfileScan IPR002048 206 241 PS50222 Calcium-binding EF-hand

IPR002048 248 273 PS50222 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	210	238	PF00036	Calcium-binding EF-hand
ProfileScan	IPR002048	206	241	PS50222	Calcium-binding EF-hand
IPR002048	248	273	PS50222	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCTGAGATGACCGCTGTGTG

Primer_r
: CGATGTTTGGATTCTGGCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCTGAGATGACCGCTGTGTG
Primer_r	: CGATGTTTGGATTCTGGCCTG
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0665

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information