HUGE

Gene/Protein Characteristic Table for KIAA1821

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06553
Accession No. :	AB058724
Description :	Rab11 family-interacting protein 4.
HUGO Gene Name :	RAB11 family interacting protein 4 (class II) (RAB11FIP4)
Clone Name :	fh12913 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5363 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3531 bp

Genome contig ID gi51511734f_26643079
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGCAACATAGTGATACCTTGTCTCTACCAAAAGTT
Flanking genome sequence
(243324 - 243373)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGCTCAAGAACCTGCACGAGGGCCTAAAACAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 26743079 26886401 15 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 609 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86YS3	1.1e-192	100.0	Rab11 family-in...	Homo sapiens
XP_523772	4.3e-184	100.0	RAB11 family in...	Pan troglodytes
XP_585093	7.9e-183	94.9	similar to RAB1...	Bos taurus
XP_001109342	8.1e-183	99.0	similar to RAB1...	Macaca mulatta
EDM05395	1.4e-177	93.0	rCG34082 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014565	7.7e-27	39.8	KIAA0665

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR002048 21 56 PS50222 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR002048	21	56	PS50222	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTTCAGAATCCTAGCTCCGGG

Primer_r
: TCAGAAGGATGGAAGACTAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3531 bp
Genome contig ID	gi51511734f_26643079
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCAACATAGTGATACCTTGTCTCTACCAAAAGTT
Flanking genome sequence (243324 - 243373)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGCTCAAGAACCTGCACGAGGGCCTAAAACAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	26743079	26886401	15	99.3	Perfect prediction

Primer_f	: TTTCAGAATCCTAGCTCCGGG
Primer_r	: TCAGAAGGATGGAAGACTAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1821

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information