HUGE

Gene/Protein Characteristic Table for KIAA0670

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04025
Accession No. :	AB014570
Description :	Apoptotic chromatin condensation inducer in the nucleus.
HUGO Gene Name :	apoptotic chromatin condensation inducer 1 (ACIN1)
Clone Name :	hk02359s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hk02359, former representative clones for KIAA0670 with hk02359s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 4444 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 581 bp

Genome contig ID gi51511730r_22497689
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
CTATGGAAAAAAAAATAAAAATCTGACTTAGTTTT
Flanking genome sequence
(99927 - 99878)
----+----*----+----*----+----*----+----*----+----*
AAACTGTGTGAGTGGCTTTCTTTGGGCAGGTTAAGAAGCCACTGTGGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 22597616 22634172 19 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1286 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UKV3	99.9	Apoptotic chrom...	Homo sapiens
XP_001160907	99.4	apoptotic chrom...	Pan troglodytes
XP_001106207	98.4	apoptotic chrom...	Macaca mulatta
XP_001494154	92.8	similar to Apop...	Equus caballus
XP_849010	91.9	similar to Apop...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003034 17 51 PF02037 DNA-binding SAP

HMMSmart IPR003034 17 51 SM00513 DNA-binding SAP

ProfileScan IPR003034 17 51 PS50800 DNA-binding SAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003034	17	51	PF02037	DNA-binding SAP
HMMSmart	IPR003034	17	51	SM00513	DNA-binding SAP
ProfileScan	IPR003034	17	51	PS50800	DNA-binding SAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTCCTCCATCCTGCTTACCAC

Primer_r
: GATATAAAGTGGAACCTGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCTCCATCCTGCTTACCAC
Primer_r	: GATATAAAGTGGAACCTGTGG
PCR product length	: 183 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	581 bp
Genome contig ID	gi51511730r_22497689
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTATGGAAAAAAAAATAAAAATCTGACTTAGTTTT
Flanking genome sequence (99927 - 99878)	----+--------+--------+--------+--------+----* AAACTGTGTGAGTGGCTTTCTTTGGGCAGGTTAAGAAGCCACTGTGGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	22597616	22634172	19	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0670

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information