HUGE

Gene/Protein Characteristic Table for KIAA0674

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01110
Accession No. :	AB014574
Description :	FK506 binding protein 15, 133kDa.
HUGO Gene Name :
Clone Name :	hk02519 [Vector Info]
Flexi ORF Clone :	pF1KA0674
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4263 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1234 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI10964	99.9	FK506 binding p...	Homo sapiens
EAW87356	100.0	hCG29188 [Homo ...	Homo sapiens
Q5T1M5	99.9	FK506-binding p...	Homo sapiens
XP_001098655	96.3	similar to Golg...	Macaca mulatta
NP_001125078	96.9	FK506 binding p...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 652 794 PD138041 NULL

HMMPfam IPR001179 204 302 PF00254 Peptidyl-prolyl cis-trans isomerase

ProfileScan IPR001179 212 305 PS50059 Peptidyl-prolyl cis-trans isomerase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	652	794	PD138041	NULL
HMMPfam	IPR001179	204	302	PF00254	Peptidyl-prolyl cis-trans isomerase
ProfileScan	IPR001179	212	305	PS50059	Peptidyl-prolyl cis-trans isomerase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCACCTGTAAGAGTCCTGTCC

Primer_r
: ACTGCACTGGGATTTAGATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCACCTGTAAGAGTCCTGTCC
Primer_r	: ACTGCACTGGGATTTAGATGG
PCR product length	: 179 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0674

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information