HUGE |
Gene/Protein Characteristic Table for KIAA0709 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01673 |
---|---|
Accession No. : | AB014609 |
Description : | Macrophage mannose receptor 2 precursor. |
HUGO Gene Name : | mannose receptor, C type 2 (MRC2) |
Clone Name : | ah06501 [Vector Info] |
Flexi ORF Clone : | pF1KA0709 |
Source : | Human brain (amygdala) |
Note : | We replaced hh01151, former representative clones for KIAA0709 with ah06501. (2004/1/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5927 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1085 bp Genome contig ID gi51511734f_57958494 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GTAGTTGATTTTTTAAATGTGCCATTATTGTTTTTFlanking genome sequence
(166137 - 166186) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGGAAAAAAGAAAAGCAAACAAATAAAACACCTTTAAGAGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 58058494 58124629 30 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1484 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACCGCAGCCCTCATCCTTTAC | |
: TGTTCTTCTCAGTGGCCTCGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: TGGGCCGCATACTTTGTCCTG | |
: TCCCTAACATCTCCAGCTCCT | |
: 203 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |