HUGE

Gene/Protein Characteristic Table for KIAA0709

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01673
Accession No. :	AB014609
Description :	Macrophage mannose receptor 2 precursor.
HUGO Gene Name :	mannose receptor, C type 2 (MRC2)
Clone Name :	ah06501 [Vector Info]
Flexi ORF Clone :	pF1KA0709
Source :	Human brain (amygdala)
Note :	We replaced hh01151, former representative clones for KIAA0709 with ah06501. (2004/1/10)

Features of the cloned DNA sequence	Description

Length: 5927 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1085 bp

Genome contig ID gi51511734f_57958494
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTAGTTGATTTTTTAAATGTGCCATTATTGTTTTT
Flanking genome sequence
(166137 - 166186)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGGAAAAAAGAAAAGCAAACAAATAAAACACCTTTAAGAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 58058494 58124629 30 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UBG0	100.0	C-type mannose ...	Homo sapiens
AAD30280	99.9	endocytic recep...	Homo sapiens
NP_006030	99.9	mannose recepto...	Homo sapiens
XP_511600	99.7	mannose recepto...	Pan troglodytes
XP_001116053	98.9	similar to mann...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D14664	4.9e-08	24.2	KIAA0022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000562 163 234 PD000995 Type II fibronectin

FPrintScan IPR000562 189 198 PR00013 Type II fibronectin

IPR000562 200 212 PR00013 Type II fibronectin

IPR000562 217 232 PR00013 Type II fibronectin

IPR002353 386 398 PR00356 Type II antifreeze protein

IPR002353 398 415 PR00356 Type II antifreeze protein

IPR002353 416 433 PR00356 Type II antifreeze protein

IPR002353 446 462 PR00356 Type II antifreeze protein

IPR002353 496 509 PR00356 Type II antifreeze protein

HMMPfam IPR000772 51 126 PF00652 Ricin B lectin

IPR000562 192 233 PF00040 Type II fibronectin

IPR001304 260 366 PF00059 C-type lectin

IPR001304 404 511 PF00059 C-type lectin

IPR001304 543 651 PF00059 C-type lectin

IPR001304 698 815 PF00059 C-type lectin

IPR001304 847 957 PF00059 C-type lectin

IPR001304 998 1114 PF00059 C-type lectin

IPR001304 1147 1250 PF00059 C-type lectin

IPR001304 1295 1361 PF00059 C-type lectin

HMMSmart IPR000772 46 166 SM00458 Ricin B lectin

IPR000562 185 233 SM00059 Type II fibronectin

IPR001304 240 365 SM00034 C-type lectin

IPR001304 387 510 SM00034 C-type lectin

IPR001304 526 650 SM00034 C-type lectin

IPR001304 674 814 SM00034 C-type lectin

IPR001304 830 956 SM00034 C-type lectin

IPR001304 977 1113 SM00034 C-type lectin

IPR001304 1130 1249 SM00034 C-type lectin

IPR001304 1266 1399 SM00034 C-type lectin

ProfileScan IPR000772 59 126 PS50231 Ricin B lectin

IPR000562 187 235 PS51092 Type II fibronectin

IPR001304 249 365 PS50041 C-type lectin

IPR001304 394 510 PS50041 C-type lectin

IPR001304 533 640 PS50041 C-type lectin

IPR001304 683 814 PS50041 C-type lectin

IPR001304 837 956 PS50041 C-type lectin

IPR001304 984 1106 PS50041 C-type lectin

IPR001304 1137 1243 PS50041 C-type lectin

IPR001304 1278 1389 PS50041 C-type lectin

ScanRegExp IPR000562 192 233 PS00023 Type II fibronectin

IPR001304 340 364 PS00615 C-type lectin

IPR001304 486 509 PS00615 C-type lectin

IPR001304 932 955 PS00615 C-type lectin

IPR002345 1224 1237 PS00213 Lipocalin

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000562	163	234	PD000995	Type II fibronectin
FPrintScan	IPR000562	189	198	PR00013	Type II fibronectin
IPR000562	200	212	PR00013	Type II fibronectin
IPR000562	217	232	PR00013	Type II fibronectin
IPR002353	386	398	PR00356	Type II antifreeze protein
IPR002353	398	415	PR00356	Type II antifreeze protein
IPR002353	416	433	PR00356	Type II antifreeze protein
IPR002353	446	462	PR00356	Type II antifreeze protein
IPR002353	496	509	PR00356	Type II antifreeze protein
HMMPfam	IPR000772	51	126	PF00652	Ricin B lectin
IPR000562	192	233	PF00040	Type II fibronectin
IPR001304	260	366	PF00059	C-type lectin
IPR001304	404	511	PF00059	C-type lectin
IPR001304	543	651	PF00059	C-type lectin
IPR001304	698	815	PF00059	C-type lectin
IPR001304	847	957	PF00059	C-type lectin
IPR001304	998	1114	PF00059	C-type lectin
IPR001304	1147	1250	PF00059	C-type lectin
IPR001304	1295	1361	PF00059	C-type lectin
HMMSmart	IPR000772	46	166	SM00458	Ricin B lectin
IPR000562	185	233	SM00059	Type II fibronectin
IPR001304	240	365	SM00034	C-type lectin
IPR001304	387	510	SM00034	C-type lectin
IPR001304	526	650	SM00034	C-type lectin
IPR001304	674	814	SM00034	C-type lectin
IPR001304	830	956	SM00034	C-type lectin
IPR001304	977	1113	SM00034	C-type lectin
IPR001304	1130	1249	SM00034	C-type lectin
IPR001304	1266	1399	SM00034	C-type lectin
ProfileScan	IPR000772	59	126	PS50231	Ricin B lectin
IPR000562	187	235	PS51092	Type II fibronectin
IPR001304	249	365	PS50041	C-type lectin
IPR001304	394	510	PS50041	C-type lectin
IPR001304	533	640	PS50041	C-type lectin
IPR001304	683	814	PS50041	C-type lectin
IPR001304	837	956	PS50041	C-type lectin
IPR001304	984	1106	PS50041	C-type lectin
IPR001304	1137	1243	PS50041	C-type lectin
IPR001304	1278	1389	PS50041	C-type lectin
ScanRegExp	IPR000562	192	233	PS00023	Type II fibronectin
IPR001304	340	364	PS00615	C-type lectin
IPR001304	486	509	PS00615	C-type lectin
IPR001304	932	955	PS00615	C-type lectin
IPR002345	1224	1237	PS00213	Lipocalin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1417 PAALVVVLMAVLLLLALLTAALI 1439 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1417	PAALVVVLMAVLLLLALLTAALI	1439	PRIMARY	23

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACCGCAGCCCTCATCCTTTAC

Primer_r
: TGTTCTTCTCAGTGGCCTCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGGGCCGCATACTTTGTCCTG
Primer_r	: TCCCTAACATCTCCAGCTCCT
PCR product length	: 203 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1085 bp
Genome contig ID	gi51511734f_57958494
PolyA signal sequence (None)	+--------+--------+----*----+---- GTAGTTGATTTTTTAAATGTGCCATTATTGTTTTT
Flanking genome sequence (166137 - 166186)	----+--------+--------+--------+--------+----* AAAAAAAAAGGAAAAAAGAAAAGCAAACAAATAAAACACCTTTAAGAGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	58058494	58124629	30	99.9	Perfect prediction

Primer_f	: ACCGCAGCCCTCATCCTTTAC
Primer_r	: TGTTCTTCTCAGTGGCCTCGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0709

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information