HUGE |
Gene/Protein Characteristic Table for KIAA0714 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01113 |
---|---|
Accession No. : | AB018257 |
Description : | Zinc finger protein 294. |
HUGO Gene Name : | ring finger protein 160 (RNF160) |
Clone Name : | pf12310 [Vector Info] |
Flexi ORF Clone : | pF1KA0714 |
Source : | Human brain (hippocampus) |
Note : | We replaced hj00574, former representative clones for KIAA0714 with pf12310. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7650 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2307 bp Genome contig ID gi51511750r_29122345 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TTCTGATTTTTAAATAAATAAAATGTTACTCTTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
GTACTTCTCCCTGGCGCCATTCTCCTCCTTCTTTCCCTAGAGCTAACGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 r 29222345 29287039 30 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1780 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AAGGTGCCTCCATTTATCAAG | |
: TAACTACCACTCCGCTTCATG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 21 |
: GeneBridge 4 | |
: GCAAACTGAGCTATTCTTACC | |
: TTAAGAGTGGCAAAAGGCAGG | |
: 167 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |