HUGE

Gene/Protein Characteristic Table for KIAA0725

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04722
Accession No. :	AB018268
Description :	DDHD domain containing 2.
HUGO Gene Name :	DDHD domain containing 2 (DDHD2)
Clone Name :	hk02781 [Vector Info]
Flexi ORF Clone :	pF1KA0725
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3911 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2188 bp

Genome contig ID gi51511724f_38114215
PolyA signal sequence
(AGTAAA,-16)
+----*----+----*----+----*----+----
TGATTATATTTAAAACTTTAGTAAATACTAAAATG
Flanking genome sequence
(125223 - 125272)
----+----*----+----*----+----*----+----*----+----*
AAACCATATTGACTAGTGGCCTACTTTTACCTGGACTCACCCGTCTCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 38214215 38239436 15 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 573 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10373	99.8	DDHD domain-con...	synthetic construct
O94830	99.7	Phospholipase D...	Homo sapiens
XP_519711	99.5	DDHD domain con...	Pan troglodytes
BAG51738	99.3	unnamed protein...	Homo sapiens
XP_532805	93.4	similar to DDHD...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051492	4.9e-12	27.6	KIAA1705
AB040890	0.00093	22.4	KIAA1457

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001660 245 307 PF00536 Sterile alpha motif SAM

IPR004177 357 562 PF02862 DDHD

HMMSmart IPR001660 244 309 SM00454 Sterile alpha motif SAM

ProfileScan IPR004177 357 562 PS51043 DDHD

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	245	307	PF00536	Sterile alpha motif SAM
IPR004177	357	562	PF02862	DDHD
HMMSmart	IPR001660	244	309	SM00454	Sterile alpha motif SAM
ProfileScan	IPR004177	357	562	PS51043	DDHD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTGGGTAACTGTGAAAGAGC

Primer_r
: ATGATACAAATGAAGCAGCGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTGGGTAACTGTGAAAGAGC
Primer_r	: ATGATACAAATGAAGCAGCGC
PCR product length	: 131 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2188 bp
Genome contig ID	gi51511724f_38114215
PolyA signal sequence (AGTAAA,-16)	+--------+--------+----*----+---- TGATTATATTTAAAACTTTAGTAAATACTAAAATG
Flanking genome sequence (125223 - 125272)	----+--------+--------+--------+--------+----* AAACCATATTGACTAGTGGCCTACTTTTACCTGGACTCACCCGTCTCAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	38214215	38239436	15	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0725

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information