HUGE |
Gene/Protein Characteristic Table for KIAA0733 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00616 |
---|---|
Accession No. : | AB018276 |
Description : | Mitogen-activated protein kinase kinase kinase 7-interacting protein 2. |
HUGO Gene Name : | mitogen-activated protein kinase kinase kinase 7 interacting protein 2 (MAP3K7IP2) |
Clone Name : | hk03729s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0733
![]() |
Source : | Human adult brain |
Note : | We replaced hk03729, former representative clones for KIAA0733 with hk03729s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4149 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1892 bp Genome contig ID gi89161210f_149632737 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
ATTTATAAAAATTAAAAAACTTATATTCTAATGTGFlanking genome sequence
(141705 - 141754) ----+----*----+----*----+----*----+----*----+----*
GATTTTGTGACTTGTTTTCAGTTTGTGGGACAGGAGATAATTTATACATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 149680756 149774440 7 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 698 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TTCTAATCCTGACTTGGTGAC | |
: AGAGATGCTTGAGGTTGCTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |