HUGE

Gene/Protein Characteristic Table for KIAA0733

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00616
Accession No. :	AB018276
Description :	Mitogen-activated protein kinase kinase kinase 7-interacting protein 2.
HUGO Gene Name :	mitogen-activated protein kinase kinase kinase 7 interacting protein 2 (MAP3K7IP2)
Clone Name :	hk03729s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0733
Source :	Human adult brain
Note :	We replaced hk03729, former representative clones for KIAA0733 with hk03729s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4149 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1892 bp

Genome contig ID gi89161210f_149632737
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
ATTTATAAAAATTAAAAAACTTATATTCTAATGTG
Flanking genome sequence
(141705 - 141754)
----+----*----+----*----+----*----+----*----+----*
GATTTTGTGACTTGTTTTCAGTTTGTGGGACAGGAGATAATTTATACATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 149680756 149774440 7 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 698 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NYJ8	100.0	Mitogen-activat...	Homo sapiens
XP_001084664	99.7	similar to mito...	Macaca mulatta
XP_541145	96.5	similar to mito...	Canis lupus fam...
XP_592279	96.7	similar to mito...	Bos taurus
XP_001502204	96.4	mitogen-activat...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003892 13 55 PF02845 Ubiquitin system component Cue

HMMSmart IPR003892 13 55 SM00546 Ubiquitin system component Cue

IPR001876 671 695 SM00547 Zinc finger

ProfileScan IPR003892 13 56 PS51140 Ubiquitin system component Cue

IPR001876 668 698 PS50199 Zinc finger

ScanRegExp IPR001876 673 692 PS01358 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003892	13	55	PF02845	Ubiquitin system component Cue
HMMSmart	IPR003892	13	55	SM00546	Ubiquitin system component Cue
IPR001876	671	695	SM00547	Zinc finger
ProfileScan	IPR003892	13	56	PS51140	Ubiquitin system component Cue
IPR001876	668	698	PS50199	Zinc finger
ScanRegExp	IPR001876	673	692	PS01358	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCTAATCCTGACTTGGTGAC

Primer_r
: AGAGATGCTTGAGGTTGCTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1892 bp
Genome contig ID	gi89161210f_149632737
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- ATTTATAAAAATTAAAAAACTTATATTCTAATGTG
Flanking genome sequence (141705 - 141754)	----+--------+--------+--------+--------+----* GATTTTGTGACTTGTTTTCAGTTTGTGGGACAGGAGATAATTTATACATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	149680756	149774440	7	99.9	Perfect prediction

Primer_f	: TTCTAATCCTGACTTGGTGAC
Primer_r	: AGAGATGCTTGAGGTTGCTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0733

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information