| HUGE |
Gene/Protein Characteristic Table for KIAA0734 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01992 |
|---|---|
| Accession No. : | AB018277 |
| Description : | BAI1-associated protein 3. |
| HUGO Gene Name : | BAI1-associated protein 3 (BAIAP3) |
| Clone Name : | hk03764s2 [Vector Info] |
| Flexi ORF Clone : | pF1KA0734
|
| Source : | Human adult brain |
| Note : | We replaced hk03764 and hk03764s1, former representative clones for KIAA0734 with hk03764s2. (2002/5/10,2008/8/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4530 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 956 bp Genome contig ID gi51511732f_1224654 PolyA signal sequence
(AATATA,-22)
ACCCAGCCTCAAAAATATATGTGTCTGCAACCCTCFlanking genome sequence
(114788 - 114837)
AGTCTCTCTGCCGTTTCTTGATTCCTTTCCAAACCTCAGCCGGGGCCCTG
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1190 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 16 |
| : GeneBridge 4 | |
| : CTGAGCGTCCGTTGCCATTAC | |
| : GACCAGTGGAAAGAGATGCGG | |
| : 150 (0.3k) bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
