HUGE |
Gene/Protein Characteristic Table for KIAA0735 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00617 |
---|---|
Accession No. : | AB018278 |
Description : | Synaptic vesicle glycoprotein 2B. |
HUGO Gene Name : | synaptic vesicle glycoprotein 2B (SV2B) |
Clone Name : | hj00943 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0735 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4948 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2732 bp Genome contig ID gi51511731f_89470349 PolyA signal sequence
(ATTAAA,-21) +----*----+----*----+----*----+----
TGATCTTTTGTTTTATTAAAAATAATTAGTGAAAGFlanking genome sequence
(169171 - 169220) ----+----*----+----*----+----*----+----*----+----*
AGGTGTGCCTATCTGTGAAGTTTGTAGTACATCATCCTGAGGTCATGTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 89570334 89639518 12 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 707 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTTAAATGCCGTCACTCCTG | |
: AGTGAAAAAGAAGTGGATGGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: GeneBridge 4 | |
: TTACCCTTCCACACAATAGCC | |
: AAAACTACAACACGTCACAGC | |
: 110 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |