HUGE |
Gene/Protein Characteristic Table for KIAA1054 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07033 |
---|---|
Accession No. : | AB028977 |
Description : | Synaptic vesicle glycoprotein 2C. |
HUGO Gene Name : | |
Clone Name : | hh05240 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5962 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 4517 bp Genome contig ID gi51511721f_75441316 PolyA signal sequence
(AGTAAA,-33) +----*----+----*----+----*----+----
TAAGTAAAGCTTCTCTTGTTATCTGTAATGTAGACFlanking genome sequence
(220331 - 220380) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACCTGTTAGTATATTCTGGATGTATTGTGTGTCCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 75526659 75661645 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 480 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTCATTTCCAAAGCAGTCCAG | |
: GAGCCTTTAGTGCATGAACAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: GeneBridge 4 | |
: GTCATTTCCAAAGCAGTCCAG | |
: GAGCCTTTAGTGCATGAACAG | |
: 159 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |