HUGE |
Gene/Protein Characteristic Table for KIAA0737 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00121 |
---|---|
Accession No. : | AB018280 |
Description : | TOX high mobility group box family member 4. |
HUGO Gene Name : | |
Clone Name : | hk03869 [Vector Info] |
Flexi ORF Clone : | pF1KA0737
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4174 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2276 bp Genome contig ID gi51511730f_20915493 PolyA signal sequence
(CATAAA,-25) +----*----+----*----+----*----+----
TGTAGAATCTCATAAAACAGTTTAAATACAAGCTTFlanking genome sequence
(121389 - 121438) ----+----*----+----*----+----*----+----*----+----*
AAGTGGCTTATGAATCCTGTGAAGCTCATTTATGGACTAGTGTAAAACAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 21015246 21036880 9 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 629 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTCACAGAGTTGCTACCAGG | |
: ACATCTTTCACCCCTTAACAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 14 |
: GeneBridge 4 | |
: CTTCACAGAGTTGCTACCAGG | |
: ACATCTTTCACCCCTTAACAG | |
: 90 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |