HUGE

Gene/Protein Characteristic Table for KIAA0808

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00132
Accession No. :	AB018351
Description :	Thymus high mobility group box protein TOX.
HUGO Gene Name :	thymocyte selection-associated high mobility group box (TOX)
Clone Name :	hk04477s1 [Vector Info]
Flexi ORF Clone :	pF1KA0808
Source :	Human adult brain
Note :	We replaced hk04477, former representative clones for KIAA0808 with hk04477s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2329 bp

Genome contig ID gi51511724r_59780531
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAAACACATCATCAATAAAACTGTTATTATGCGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCGTATTCTATTTGGTGATCCATCAGTCTCTAAAAAGCAAGCCTAGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 59880531 60194321 9 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 530 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O94900	7.6e-175	100.0	Thymocyte selec...	Homo sapiens
XP_001088869	1.4e-174	99.8	similar to thym...	Macaca mulatta
AAH16665	3.4e-174	99.8	Thymocyte selec...	Homo sapiens
AAI47900	8.7e-167	95.4	TOX protein [Bo...	Bos taurus
XP_001928498	1.4e-165	95.3	similar to thym...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018280	2.1e-23	36.3	KIAA0737

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000135 280 298 PR00886 High mobility group box HMG1 and HMG2

IPR000135 298 317 PR00886 High mobility group box HMG1 and HMG2

IPR000135 317 337 PR00886 High mobility group box HMG1 and HMG2

HMMPfam IPR000910 265 333 PF00505 HMG1/2 (high mobility group) box

HMMSmart IPR000910 264 334 SM00398 HMG1/2 (high mobility group) box

ProfileScan IPR000910 265 333 PS50118 HMG1/2 (high mobility group) box

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000135	280	298	PR00886	High mobility group box HMG1 and HMG2
IPR000135	298	317	PR00886	High mobility group box HMG1 and HMG2
IPR000135	317	337	PR00886	High mobility group box HMG1 and HMG2
HMMPfam	IPR000910	265	333	PF00505	HMG1/2 (high mobility group) box
HMMSmart	IPR000910	264	334	SM00398	HMG1/2 (high mobility group) box
ProfileScan	IPR000910	265	333	PS50118	HMG1/2 (high mobility group) box

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTACTGGGAGGAGAATGAGCA

Primer_r
: TCAACACTCTCTACCCTGGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2329 bp
Genome contig ID	gi51511724r_59780531
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAACACATCATCAATAAAACTGTTATTATGCGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCGTATTCTATTTGGTGATCCATCAGTCTCTAAAAAGCAAGCCTAGTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	59880531	60194321	9	99.3	Perfect prediction

Primer_f	: TTACTGGGAGGAGAATGAGCA
Primer_r	: TCAACACTCTCTACCCTGGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0808

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information