HUGE

Gene/Protein Characteristic Table for KIAA0740

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00122
Accession No. :	AB018283
Description :	Rho-related BTB domain-containing protein 1.
HUGO Gene Name :	Rho-related BTB domain containing 1 (RHOBTB1)
Clone Name :	hk03989s1 [Vector Info]
Flexi ORF Clone :	pF1KA0740
Source :	Human adult brain
Note :	We replaced hk03989, former representative clones for KIAA0740 with hk03989s1. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 4388 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2040 bp

Genome contig ID gi89161187r_62199206
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TATTTCACAAAAAGCCAATAAAATTGTTTAGCTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGCCTCCAGTTTTGTTTTAAGGACAGACATCATATTGTGTGTGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 62299206 62373930 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 696 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_507810	99.4	Rho-related BTB...	Pan troglodytes
CAH91062	98.9	hypothetical pr...	Pongo abelii
XP_001094923	97.8	Rho-related BTB...	Macaca mulatta
XP_001503521	94.4	similar to Rho-...	Equus caballus
XP_546116	93.1	similar to Rho-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018260	2.1e-87	68.0	KIAA0717
AB020685	5.7e-14	24.1	KIAA0878

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001806 15 36 PR00449 Ras GTPase

IPR001806 71 93 PR00449 Ras GTPase

IPR001806 131 144 PR00449 Ras GTPase

IPR001806 185 207 PR00449 Ras GTPase

HMMPfam IPR013753 100 209 PF00071 Ras

IPR013069 260 457 PF00651 BTB/POZ

IPR013069 475 583 PF00651 BTB/POZ

HMMSmart IPR003577 12 210 SM00173 Ras small GTPase

IPR003579 15 210 SM00175 Ras small GTPase

IPR003578 17 210 SM00174 Ras small GTPase

IPR000210 266 457 SM00225 BTB/POZ-like

IPR000210 485 583 SM00225 BTB/POZ-like

HMMTigr IPR005225 12 188 TIGR00231 Small GTP-binding protein domain

ProfileScan IPR000210 266 427 PS50097 BTB/POZ-like

IPR000210 485 552 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	15	36	PR00449	Ras GTPase
IPR001806	71	93	PR00449	Ras GTPase
IPR001806	131	144	PR00449	Ras GTPase
IPR001806	185	207	PR00449	Ras GTPase
HMMPfam	IPR013753	100	209	PF00071	Ras
IPR013069	260	457	PF00651	BTB/POZ
IPR013069	475	583	PF00651	BTB/POZ
HMMSmart	IPR003577	12	210	SM00173	Ras small GTPase
IPR003579	15	210	SM00175	Ras small GTPase
IPR003578	17	210	SM00174	Ras small GTPase
IPR000210	266	457	SM00225	BTB/POZ-like
IPR000210	485	583	SM00225	BTB/POZ-like
HMMTigr	IPR005225	12	188	TIGR00231	Small GTP-binding protein domain
ProfileScan	IPR000210	266	427	PS50097	BTB/POZ-like
IPR000210	485	552	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAAGTAGGCTAAGGCAGACC

Primer_r
: TCAGAACGAACTCACAATAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2040 bp
Genome contig ID	gi89161187r_62199206
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTTCACAAAAAGCCAATAAAATTGTTTAGCTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGCCTCCAGTTTTGTTTTAAGGACAGACATCATATTGTGTGTGTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	62299206	62373930	11	100.0	Perfect prediction

Primer_f	: AGAAGTAGGCTAAGGCAGACC
Primer_r	: TCAGAACGAACTCACAATAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0740

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information