HUGE

Gene/Protein Characteristic Table for KIAA0742

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01605
Accession No. :	AB018285
Description :	JmjC domain-containing histone demethylation protein 2A.
HUGO Gene Name :	jumonji domain containing 1A (JMJD1A)
Clone Name :	hk04073s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0742
Source :	Human adult brain
Note :	We replaced hk04073, former representative clones for KIAA0742 with hk04073s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4652 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 596 bp

Genome contig ID gi89161199f_86422019
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GTGTTAAGCATTTTGCATTAAAATATTCATATAAT
Flanking genome sequence
(151332 - 151381)
----+----*----+----*----+----*----+----*----+----*
ATTTTGGCTCAGTTTATTGGCATTATCCTCTCATTGTGGTTTCAACACAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 86522019 86573349 26 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1338 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525805	99.6	jumonji domain ...	Pan troglodytes
Q9Y4C1	100.0	JmjC domain-con...	Homo sapiens
AAY24210	99.9	unknown [Homo s...	Homo sapiens
CAH18373	99.8	hypothetical pr...	Homo sapiens
CAE45820	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029005	6.1e-89	59.4	KIAA1082
AB037801	2.3e-60	41.7	KIAA1380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013129 1168 1281 PF02373 Transcription factor jumonji

HMMSmart IPR003347 1075 1298 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

ProfileScan IPR003347 1075 1298 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	1168	1281	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	1075	1298	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	1075	1298	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACCTCGTATCAGCTCTGGAAC

Primer_r
: CTGTCACTTCCTCCATTGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACCTCGTATCAGCTCTGGAAC
Primer_r	: CTGTCACTTCCTCCATTGCTC
PCR product length	: 172 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	596 bp
Genome contig ID	gi89161199f_86422019
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GTGTTAAGCATTTTGCATTAAAATATTCATATAAT
Flanking genome sequence (151332 - 151381)	----+--------+--------+--------+--------+----* ATTTTGGCTCAGTTTATTGGCATTATCCTCTCATTGTGGTTTCAACACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	86522019	86573349	26	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0742

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information