HUGE

Gene/Protein Characteristic Table for KIAA1082

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05559
Accession No. :	AB029005
Description :	JmjC domain-containing histone demethylation protein 2B.
HUGO Gene Name :	jumonji domain containing 1B (JMJD1B)
Clone Name :	fg06837 [Vector Info]
Flexi ORF Clone :	pF1KA1082
Source :	Human fetal brain
Note :	We replaced hj07386, former representative clones for KIAA1082 with fg06837. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6691 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1325 bp

Genome contig ID gi51511721f_137616400
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ATTTCCATGTTCTTATTAAAAATCTAACAAATCTG
Flanking genome sequence
(184217 - 184266)
----+----*----+----*----+----*----+----*----+----*
TTTGGAGTGGACTAAATTATTCGTGTACCAACCCTTCTAAAATCAACATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 137716304 137800615 24 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1787 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_517956	99.8	jumonji domain ...	Pan troglodytes
Q7LBC6	100.0	JmjC domain-con...	Homo sapiens
XP_873047	96.1	similar to jumo...	Bos taurus
NP_001074725	93.6	jumonji domain ...	Mus musculus
EDL76245	93.5	rCG49501 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018285	1.2e-77	59.6	KIAA0742
AB037801	7.1e-63	40.1	KIAA1380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013129 1619 1730 PF02373 Transcription factor jumonji

HMMSmart IPR003347 1524 1747 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase

ProfileScan IPR003347 1524 1747 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	1619	1730	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	1524	1747	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	1524	1747	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCCATCTTAGTCTTACCTTG

Primer_r
: GAAACATTAAGAGGAGTCCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCCCATCTTAGTCTTACCTTG
Primer_r	: GAAACATTAAGAGGAGTCCCC
PCR product length	: 158 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1325 bp
Genome contig ID	gi51511721f_137616400
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATTTCCATGTTCTTATTAAAAATCTAACAAATCTG
Flanking genome sequence (184217 - 184266)	----+--------+--------+--------+--------+----* TTTGGAGTGGACTAAATTATTCGTGTACCAACCCTTCTAAAATCAACATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	137716304	137800615	24	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA1082

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information