HUGE |
Gene/Protein Characteristic Table for KIAA0754 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05620 |
---|---|
Accession No. : | AB018297 |
Description : | |
HUGO Gene Name : | |
Clone Name : | hh06485 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hk04470, former representative clones for KIAA0754 with hh06485. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5460 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1933 bp Genome contig ID gi89161185f_39549282 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAGCCTAGGCAACATAGTAAGACCCCATCTCTGAGFlanking genome sequence
(105461 - 105510) ----+----*----+----*----+----*----+----*----+----*
AAAATAAAAAGAAAAAAAAAAAAACAGAATATCTCCAGTATAAAGCTTAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 39649282 39654741 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1174 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATAATCTGGCCTTGCTGAGTG | |
: TACAGGCTATTGGGATCTCGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: ATAATCTGGCCTTGCTGAGTG | |
: TACAGGCTATTGGGATCTCGG | |
: 171 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |