HUGE

Gene/Protein Characteristic Table for KIAA1681

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06593
Accession No. :	AB051468
Description :	Ras-associated and pleckstrin homology domains-containing protein 1.
HUGO Gene Name :	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 (RAPH1)
Clone Name :	fh23697 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5135 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1424 bp

Genome contig ID gi89161199r_203911003
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAACGACACACTAGTTCTAGATCGCGAGCGGCCGC
Flanking genome sequence
(257277 - 257228)
----+----*----+----*----+----*----+----*----+----*
AACACCCCAGAAATGGTAAAACTAGAAAGGAGAAGAGAGTGATTCTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 204010992 204068279 13 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 1236 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE48361	100.0	RAPH1 protein [...	Homo sapiens
Q70E73	99.9	Ras-associated ...	Homo sapiens
XP_516044	97.4	Ras association...	Pan troglodytes
EAW70345	95.9	Ras association...	Homo sapiens
XP_001173361	93.5	Ras association...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007927	2e-06	28.1	KIAA0458
D86962	1e-05	28.4	KIAA0207
AB040955	1.5e-05	25.7	KIAA1522
AB002302	8.7e-05	27.3	KIAA0304
AB067474	0.00046	26.6	KIAA1887

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001904 694 717 PR00832 Paxillin

IPR001904 805 828 PR00832 Paxillin

IPR001904 860 879 PR00832 Paxillin

HMMPfam IPR000159 255 342 PF00788 Ras-association

IPR001849 383 491 PF00169 Pleckstrin-like

HMMSmart IPR000159 255 341 SM00314 Ras-association

IPR001849 383 493 SM00233 Pleckstrin-like

ProfileScan IPR000159 255 341 PS50200 Ras-association

IPR001849 382 491 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001904	694	717	PR00832	Paxillin
IPR001904	805	828	PR00832	Paxillin
IPR001904	860	879	PR00832	Paxillin
HMMPfam	IPR000159	255	342	PF00788	Ras-association
IPR001849	383	491	PF00169	Pleckstrin-like
HMMSmart	IPR000159	255	341	SM00314	Ras-association
IPR001849	383	493	SM00233	Pleckstrin-like
ProfileScan	IPR000159	255	341	PS50200	Ras-association
IPR001849	382	491	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCATTTATAGCTACTGGGGC

Primer_r
: GCACTGACTCCACGTTATACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: CCR
Primer_f	: TTCATTTATAGCTACTGGGGC
Primer_r	: GCACTGACTCCACGTTATACC
PCR product length	: 160 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1424 bp
Genome contig ID	gi89161199r_203911003
PolyA signal sequence (None)	+--------+--------+----*----+---- TAACGACACACTAGTTCTAGATCGCGAGCGGCCGC
Flanking genome sequence (257277 - 257228)	----+--------+--------+--------+--------+----* AACACCCCAGAAATGGTAAAACTAGAAAGGAGAAGAGAGTGATTCTTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	204010992	204068279	13	99.3	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1681

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information