HUGE

Gene/Protein Characteristic Table for KIAA0458

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK06630
Accession No. :	AB007927
Description :	Arginine-glutamic acid dipeptide repeats protein.
HUGO Gene Name :	arginine-glutamic acid dipeptide (RE) repeats (RERE)
Clone Name :	ef01252 [Vector Info]
Flexi ORF Clone :	pF1KA0458
Source :
Note :	We replaced hg00715, former representative clones for KIAA0458 with ef01252. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2680 bp

Genome contig ID gi89161185r_8235053
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATTTGTGGACATAAATAAAACCAAGCTACACTAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCCTTGGGTGTCTCCCGTGCACTGTCTCATTCCTGGAGAGTGGGCGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 8335053 8638903 22 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1552 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2R6	100.0	Arginine-glutam...	Homo sapiens
XP_001159355	99.7	atrophin-1 like...	Pan troglodytes
BAA95898	99.5	RERE [Homo sapi...	Homo sapiens
XP_001097280	99.4	similar to atro...	Macaca mulatta
XP_001159210	98.8	atrophin-1 like...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	2e-06	28.3	KIAA1681
AB051547	7.8e-05	24.9	KIAA1760
AB040955	0.00027	25.6	KIAA1522
AB040904	0.00046	25.7	KIAA1471
AB028999	0.0008	25.7	KIAA1076

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001025 89 269 PF01426 Bromo adjacent region

IPR000949 270 329 PF01448 ELM2

IPR014778 379 425 PF00249 Myb

IPR000679 493 528 PF00320 Zinc finger

IPR002951 554 1552 PF03154 Atrophin

HMMSmart IPR001025 89 269 SM00439 Bromo adjacent region

IPR001005 378 427 SM00717 SANT

IPR000679 487 538 SM00401 Zinc finger

ProfileScan IPR001025 89 269 PS51038 Bromo adjacent region

IPR000949 270 373 PS51156 ELM2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	89	269	PF01426	Bromo adjacent region
IPR000949	270	329	PF01448	ELM2
IPR014778	379	425	PF00249	Myb
IPR000679	493	528	PF00320	Zinc finger
IPR002951	554	1552	PF03154	Atrophin
HMMSmart	IPR001025	89	269	SM00439	Bromo adjacent region
IPR001005	378	427	SM00717	SANT
IPR000679	487	538	SM00401	Zinc finger
ProfileScan	IPR001025	89	269	PS51038	Bromo adjacent region
IPR000949	270	373	PS51156	ELM2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACGATTTCTGGGTGTCTACTG
Primer_r	: CGTATCTTGTTCGGTGTCCTC
PCR product length	: 163 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2680 bp
Genome contig ID	gi89161185r_8235053
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATTTGTGGACATAAATAAAACCAAGCTACACTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCTTGGGTGTCTCCCGTGCACTGTCTCATTCCTGGAGAGTGGGCGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	8335053	8638903	22	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0458

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information