HUGE

Gene/Protein Characteristic Table for KIAA1760

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK02051
Accession No. :	AB051547
Description :	Serine/threonine-protein kinase WNK2.
HUGO Gene Name :	WNK lysine deficient protein kinase 2 (WNK2)
Clone Name :	af00030 [Vector Info]
Flexi ORF Clone :	pF1KA1760
Source :	Human brain (amygdala)
Note :	We replaced fh22167, former representative clones for KIAA1760 with af00030. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 7792 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1130 bp

Genome contig ID gi89161216f_94887142
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TATATCTGAAGGAGAAAAATAAACACTTTTGCTCG
Flanking genome sequence
(234167 - 234216)
----+----*----+----*----+----*----+----*----+----*
AAAACAGTGTGAAACAACATCTTTTTCTTACCCTCTATCCATATAAAATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 94987046 95121307 29 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72864	100.0	WNK lysine defi...	synthetic construct
NP_006639	100.0	WNK lysine defi...	Homo sapiens
EAW62860	99.0	WNK lysine defi...	Homo sapiens
EAW62859	99.0	WNK lysine defi...	Homo sapiens
EAW62858	99.0	WNK lysine defi...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002342	5.5e-35	34.0	KIAA0344
AB046786	7.9e-06	25.4	KIAA1566
AB007927	4.2e-05	25.0	KIAA0458
AB040904	0.0001	29.2	KIAA1471
AB002307	0.00014	23.5	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 196 448 PD000001 Protein kinase

HMMPfam IPR000719 190 448 PF00069 Protein kinase

HMMSmart IPR001245 190 448 SM00219 Tyrosine protein kinase

IPR002290 190 448 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 190 448 PS50011 Protein kinase

ScanRegExp IPR008271 314 326 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	196	448	PD000001	Protein kinase
HMMPfam	IPR000719	190	448	PF00069	Protein kinase
HMMSmart	IPR001245	190	448	SM00219	Tyrosine protein kinase
IPR002290	190	448	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	190	448	PS50011	Protein kinase
ScanRegExp	IPR008271	314	326	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1130 bp
Genome contig ID	gi89161216f_94887142
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TATATCTGAAGGAGAAAAATAAACACTTTTGCTCG
Flanking genome sequence (234167 - 234216)	----+--------+--------+--------+--------+----* AAAACAGTGTGAAACAACATCTTTTTCTTACCCTCTATCCATATAAAATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	94987046	95121307	29	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1760

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information