HUGE |
Gene/Protein Characteristic Table for KIAA1760 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK02051 |
---|---|
Accession No. : | AB051547 |
Description : | Serine/threonine-protein kinase WNK2. |
HUGO Gene Name : | WNK lysine deficient protein kinase 2 (WNK2) |
Clone Name : | af00030 [Vector Info] |
Flexi ORF Clone : | pF1KA1760
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced fh22167, former representative clones for KIAA1760 with af00030. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7792 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1130 bp Genome contig ID gi89161216f_94887142 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TATATCTGAAGGAGAAAAATAAACACTTTTGCTCGFlanking genome sequence
(234167 - 234216) ----+----*----+----*----+----*----+----*----+----*
AAAACAGTGTGAAACAACATCTTTTTCTTACCCTCTATCCATATAAAATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 94987046 95121307 29 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2219 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 9 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |