HUGE

Gene/Protein Characteristic Table for KIAA1566

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07368
Accession No. :	AB046786
Description :	Serine/threonine-protein kinase WNK3.
HUGO Gene Name :
Clone Name :	fh21445 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5844 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1901 bp

Genome contig ID gi89161218r_54139631
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACAGTCTACTTTGTGACATTAAGTACCTCTTTTCC
Flanking genome sequence
(99949 - 99900)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATGTGTTTTATGTTGCTTACCTGAGGATCACATCCA

Features of the protein sequence	Description

Length: 1313 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BYP7	99.9	Serine/threonin...	Homo sapiens
XP_001146822	99.3	WNK lysine defi...	Pan troglodytes
XP_001089789	97.2	WNK lysine defi...	Macaca mulatta
XP_001495798	87.7	similar to Seri...	Equus caballus
XP_864627	84.3	similar to Seri...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051547	2.3e-15	25.5	KIAA1760
AB002342	1.7e-11	26.9	KIAA0344

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCACTCTGAAGACTTTAAGG

Primer_r
: TTTCGTCATTACCTGGCAAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1901 bp
Genome contig ID	gi89161218r_54139631
PolyA signal sequence (None)	+--------+--------+----*----+---- ACAGTCTACTTTGTGACATTAAGTACCTCTTTTCC
Flanking genome sequence (99949 - 99900)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAATGTGTTTTATGTTGCTTACCTGAGGATCACATCCA

Primer_f	: TCCACTCTGAAGACTTTAAGG
Primer_r	: TTTCGTCATTACCTGGCAAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1566

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information