HUGE |
Gene/Protein Characteristic Table for KIAA0344 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07367 |
---|---|
Accession No. : | AB002342 |
Description : | Serine/threonine-protein kinase WNK1. |
HUGO Gene Name : | |
Clone Name : | hg01568 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg01486, former representative clones for KIAA0344 with hg01568. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6812 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 609 bp Genome contig ID gi89161190f_633195 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAAAAGATATTAGCAGCTTTGACTGCAGCATTAGCFlanking genome sequence
(255635 - 255684) ----+----*----+----*----+----*----+----*----+----*
AATTAGGAAAAAAAAAAAATTAAGTTCCCTGCGGACATGTAACTTTGCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 733195 888828 26 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2066 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: ACCATATCCACTCTCTGTCAC | |
: TGTTTCACGCAGTCCATTTTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: ACCATATCCACTCTCTGTCAC | |
: TGTTTCACGCAGTCCATTTTC | |
: 206 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |