Gene/Protein Characteristic Table for KIAA0344

Length: 6812 bp

Restriction map

Length of 3'UTR	609 bp
Genome contig ID	gi89161190f_633195
PolyA signal sequence (None)	+----*----+----*----+----*----+---- CAAAAGATATTAGCAGCTTTGACTGCAGCATTAGC
Flanking genome sequence (255635 - 255684)	----+----*----+----*----+----*----+----*----+----* AATTAGGAAAAAAAAAAAATTAAGTTCCCTGCGGACATGTAACTTTGCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	733195	888828	26	99.6	Perfect prediction

Length: 2066 aa

Entry Exp ID% Protein Source XP_001150489 0 99.0 WNK lysine defi... Pan troglodytes XP_001095637 0 96.8 similar to WNK ... Macaca mulatta EAW88958 0 99.9 WNK lysine defi... Homo sapiens AAS45192 0 85.4 protein kinase ... Mus musculus AAI38446 0 85.4 Wnk1 protein [M... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID AB051547 2.2e-46 33.9 KIAA1760 AB046786 4.8e-06 27.0 KIAA1566 AB058763 5.3e-05 22.7 KIAA1860 AB033104 5.4e-05 26.7 KIAA1278 AB067488 8.5e-05 20.9 KIAA1901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	159	411	PD000001	Protein kinase
HMMPfam	IPR000719	153	411	PF00069	Protein kinase
HMMSmart	IPR001245	153	411	SM00219	Tyrosine protein kinase
	IPR002290	153	411	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	153	411	PS50011	Protein kinase
ScanRegExp	IPR008271	277	289	PS00108	Serine/threonine protein kinase

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-