HUGE |
Gene/Protein Characteristic Table for KIAA0309 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01065 |
---|---|
Accession No. : | AB002307 |
Description : | Snf2-related CBP activator protein. |
HUGO Gene Name : | Snf2-related CREBBP activator protein (SRCAP) |
Clone Name : | hg00096s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0309
![]() |
Source : | Human adult brain |
Note : | We replaced hg00096, former representative clones for KIAA0309 with hg00096s1. (2003/8/28) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10802 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1640 bp Genome contig ID gi51511732f_30522889 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AATTCATTTTGTAATAAAAGCCTTTTTTAGTGGTGFlanking genome sequence
(140213 - 140262) ----+----*----+----*----+----*----+----*----+----*
AAATACTCCTGTCTAATTGTTCTCCTCCTGCTTTCCCTTGGGCCCTTGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 30622889 30663100 31 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3053 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TGCCCTCCTCTCATCAGTCTC | |
: TGGTTGGAAGGATGGGGACTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: TGCCCTCCTCTCATCAGTCTC | |
: TGGTTGGAAGGATGGGGACTC | |
: 98 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |