HUGE

Gene/Protein Characteristic Table for KIAA0309

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01065
Accession No. :	AB002307
Description :	Snf2-related CBP activator protein.
HUGO Gene Name :	Snf2-related CREBBP activator protein (SRCAP)
Clone Name :	hg00096s1 [Vector Info]
Flexi ORF Clone :	pF1KA0309
Source :	Human adult brain
Note :	We replaced hg00096, former representative clones for KIAA0309 with hg00096s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10802 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1640 bp

Genome contig ID gi51511732f_30522889
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AATTCATTTTGTAATAAAAGCCTTTTTTAGTGGTG
Flanking genome sequence
(140213 - 140262)
----+----*----+----*----+----*----+----*----+----*
AAATACTCCTGTCTAATTGTTCTCCTCCTGCTTTCCCTTGGGCCCTTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 30622889 30663100 31 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 3053 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI59100	100.0	SRCAP protein [...	Homo sapiens
EAW52213	96.9	Snf2-related CB...	Homo sapiens
AAD39760	96.7	transcriptional...	Homo sapiens
NP_006653	95.0	Snf2-related CB...	Homo sapiens
Q6ZRS2	95.0	Helicase SRCAP;...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040931	1.1e-26	35.2	KIAA1498
AB033085	3.3e-09	45.1	KIAA1259
AB007913	7.1e-07	33.6	KIAA0444
AB032948	3.6e-06	29.5	KIAA1122
AB046784	6.6e-06	27.5	KIAA1564

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 2680 2690 PR00929 HMG-I and HMG-Y

IPR000637 2757 2768 PR00929 HMG-I and HMG-Y

IPR000637 2825 2835 PR00929 HMG-I and HMG-Y

HMMPfam IPR006562 106 177 PF07529 HSA

IPR000330 602 888 PF00176 SNF2-related

IPR001650 1901 1979 PF00271 DNA/RNA helicase

IPR000637 2680 2692 PF02178 HMG-I and HMG-Y

IPR000637 2759 2771 PF02178 HMG-I and HMG-Y

IPR000637 2827 2839 PF02178 HMG-I and HMG-Y

HMMSmart IPR013999 106 177 SM00573 HAS subgroup

IPR014001 595 787 SM00487 DEAD-like helicases

IPR001650 1896 1979 SM00490 DNA/RNA helicase

IPR000637 2680 2692 SM00384 HMG-I and HMG-Y

IPR000637 2759 2771 SM00384 HMG-I and HMG-Y

IPR000637 2827 2839 SM00384 HMG-I and HMG-Y

ProfileScan IPR014012 105 177 PS51204 Helicase/SANT-associated

IPR014021 611 776 PS51192 Helicase

IPR001650 1867 2020 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	2680	2690	PR00929	HMG-I and HMG-Y
IPR000637	2757	2768	PR00929	HMG-I and HMG-Y
IPR000637	2825	2835	PR00929	HMG-I and HMG-Y
HMMPfam	IPR006562	106	177	PF07529	HSA
IPR000330	602	888	PF00176	SNF2-related
IPR001650	1901	1979	PF00271	DNA/RNA helicase
IPR000637	2680	2692	PF02178	HMG-I and HMG-Y
IPR000637	2759	2771	PF02178	HMG-I and HMG-Y
IPR000637	2827	2839	PF02178	HMG-I and HMG-Y
HMMSmart	IPR013999	106	177	SM00573	HAS subgroup
IPR014001	595	787	SM00487	DEAD-like helicases
IPR001650	1896	1979	SM00490	DNA/RNA helicase
IPR000637	2680	2692	SM00384	HMG-I and HMG-Y
IPR000637	2759	2771	SM00384	HMG-I and HMG-Y
IPR000637	2827	2839	SM00384	HMG-I and HMG-Y
ProfileScan	IPR014012	105	177	PS51204	Helicase/SANT-associated
IPR014021	611	776	PS51192	Helicase
IPR001650	1867	2020	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGCCCTCCTCTCATCAGTCTC

Primer_r
: TGGTTGGAAGGATGGGGACTC

PCR conditions
: 95 °C15 sec64 °C15 sec72 °C45 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCCCTCCTCTCATCAGTCTC
Primer_r	: TGGTTGGAAGGATGGGGACTC
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1640 bp
Genome contig ID	gi51511732f_30522889
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATTCATTTTGTAATAAAAGCCTTTTTTAGTGGTG
Flanking genome sequence (140213 - 140262)	----+--------+--------+--------+--------+----* AAATACTCCTGTCTAATTGTTCTCCTCCTGCTTTCCCTTGGGCCCTTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	30622889	30663100	31	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0309

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information