HUGE

Gene/Protein Characteristic Table for KIAA1122

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01153
Accession No. :	AB032948
Description :	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A containing DEAD/H box 1.
HUGO Gene Name :	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 (SMARCAD1)
Clone Name :	hj01698 [Vector Info]
Flexi ORF Clone :	pF1KA1122
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4906 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1756 bp

Genome contig ID gi89161207f_95248520
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATGTCTTGGGCTTAATAAAAATATTTGTGATCAT
Flanking genome sequence
(182946 - 182995)
----+----*----+----*----+----*----+----*----+----*
AAGTTGTATTTTCACACCCTTTTTAATAGTTTCTAACCCTTCCTCCTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 95347896 95431464 24 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1040 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06051	100.0	SWI/SNF-related...	Homo sapiens
EAX06050	99.8	SWI/SNF-related...	Homo sapiens
AAH45534	99.6	SWI/SNF-related...	Homo sapiens
Q9H4L7	99.7	SWI/SNF-related...	Homo sapiens
XP_001251200	96.8	similar to SWI/...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	3.2e-18	29.5	KIAA0309
AB033085	3.3e-18	26.0	KIAA1259
AB040931	1.1e-15	27.0	KIAA1498
AB046784	4.7e-15	25.6	KIAA1564
AB007913	1.5e-14	41.6	KIAA0444

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 512 802 PF00176 SNF2-related

IPR001650 903 981 PF00271 Helicase

HMMSmart IPR011545 505 699 SM00487 DEAD/DEAH box helicase

IPR001650 898 981 SM00490 Helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	512	802	PF00176	SNF2-related
IPR001650	903	981	PF00271	Helicase
HMMSmart	IPR011545	505	699	SM00487	DEAD/DEAH box helicase
IPR001650	898	981	SM00490	Helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTTATTACTGCCACATCTCC

Primer_r
: GACCTATTTCCATGCAGTACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1756 bp
Genome contig ID	gi89161207f_95248520
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATGTCTTGGGCTTAATAAAAATATTTGTGATCAT
Flanking genome sequence (182946 - 182995)	----+--------+--------+--------+--------+----* AAGTTGTATTTTCACACCCTTTTTAATAGTTTCTAACCCTTCCTCCTCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	95347896	95431464	24	100.0	Perfect prediction

Primer_f	: GTTTATTACTGCCACATCTCC
Primer_r	: GACCTATTTCCATGCAGTACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1122

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information