HUGE

Gene/Protein Characteristic Table for KIAA1498

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05665
Accession No. :	AB040931
Description :	E1A-binding protein p400.
HUGO Gene Name :	E1A binding protein p400 (EP400)
Clone Name :	hh01611 [Vector Info]
Flexi ORF Clone :	pF1KSDA1498
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5197 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161190f_130911113
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CCGGTGGTGGCAGCACCCCCGTCCCTACGGGTGCC
Flanking genome sequence
(169141 - 169190)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCACCCCTGTACAGCCACAGAATGAGGATCTTGAGGCAGGGCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 131011113 131080252 26 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1731 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50292	100.0	EP400 protein [...	Homo sapiens
BAG10081	100.0	E1A binding pro...	synthetic construct
AAK97789	95.4	p400 SWI2/SNF2-...	Homo sapiens
EAW98536	95.5	E1A binding pro...	Homo sapiens
NP_056224	95.4	E1A binding pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002307	6e-33	35.0	KIAA0309
AB033085	1.6e-08	27.3	KIAA1259
AB032948	9.4e-07	26.8	KIAA1122
AB046784	4.1e-06	23.9	KIAA1564
AB002306	0.00061	30.3	KIAA0308

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006562 765 836 PF07529 HSA

IPR000330 1059 1339 PF00176 SNF2-related

HMMSmart IPR013999 765 836 SM00573 HAS subgroup

IPR014001 1052 1241 SM00487 DEAD-like helicases

ProfileScan IPR014012 764 836 PS51204 Helicase/SANT-associated

IPR014021 1068 1233 PS51192 Helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006562	765	836	PF07529	HSA
IPR000330	1059	1339	PF00176	SNF2-related
HMMSmart	IPR013999	765	836	SM00573	HAS subgroup
IPR014001	1052	1241	SM00487	DEAD-like helicases
ProfileScan	IPR014012	764	836	PS51204	Helicase/SANT-associated
IPR014021	1068	1233	PS51192	Helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCGCATCTCTAATCCTGAAGG

Primer_r
: ACTGCACAGGCTGAAACAACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCGCATCTCTAATCCTGAAGG
Primer_r	: ACTGCACAGGCTGAAACAACC
PCR product length	: 231(2k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi89161190f_130911113
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGGTGGTGGCAGCACCCCCGTCCCTACGGGTGCC
Flanking genome sequence (169141 - 169190)	----+--------+--------+--------+--------+----* GCGGCCGCCACCCCTGTACAGCCACAGAATGAGGATCTTGAGGCAGGGCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	131011113	131080252	26	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1498

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information