HUGE |
Gene/Protein Characteristic Table for KIAA0308 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04552 |
---|---|
Accession No. : | AB002306 |
Description : | Chromodomain-helicase-DNA-binding protein 9. |
HUGO Gene Name : | chromodomain helicase DNA binding protein 9 (CHD9) |
Clone Name : | ee00163 [Vector Info] |
Source : | |
Note : | We replaced hg00088 and hg00088s1, former representative clones for KIAA0308 with ee00163. (2003/8/28,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10256 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1975 bp Genome contig ID gi51511732f_51647871 PolyA signal sequence
(None) +----*----+----*----+----*----+----
ACCCACATGATCTTTATTCCTTCCTTTCGCCAATTFlanking genome sequence
(270414 - 270463) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAGGAAAAAAAATCTGTAGATCTTGTCACTAAAATCTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 51747871 51918283 38 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2759 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GACTACACAAAACACAACTGG | |
: GAAAAGTTGTCCAGCTATCAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: GeneBridge 4 | |
: GACTACACAAAACACAACTGG | |
: GAAAAGTTGTCCAGCTATCAG | |
: 268 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |