HUGE

Gene/Protein Characteristic Table for KIAA1335

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04549
Accession No. :	AB037756
Description :	Chromodomain-helicase-DNA-binding protein 6.
HUGO Gene Name :	chromodomain helicase DNA binding protein 6 (CHD6)
Clone Name :	bf00973 [Vector Info]
Source :	Human adult brain
Note :	We replaced fh16079, former representative clones for KIAA1335 with bf00973. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8116 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1989 bp

Genome contig ID gi51511747r_39364658
PolyA signal sequence
(AATACA,-14)
+----*----+----*----+----*----+----
GTATTTGCCCTAAATCCTTAAAATACAAATGCTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAATTCCTGTATCTTGAAAGCCTTACTGCAAATGAGTATTATAGACAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 39464658 39546641 23 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2041 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI22255	100.0	chromodomain he...	Homo sapiens
EAW75976	100.0	chromodomain he...	Homo sapiens
Q8TD26	100.0	Chromodomain-he...	Homo sapiens
AAK56405	99.9	chromodomain he...	Homo sapiens
XP_001147951	99.8	chromodomain he...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046784	8.8e-164	65.4	KIAA1564
AB037837	1.2e-139	47.8	KIAA1416
AB002306	7.5e-129	43.7	KIAA0308
AB007913	1.2e-22	30.4	KIAA0444
AB033085	4.2e-15	36.9	KIAA1259

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 1 77 PF00176 SNF2-related

IPR001650 144 223 PF00271 DNA/RNA helicase

IPR006576 1728 1768 PF07533 BRK

HMMSmart IPR001650 139 223 SM00490 DNA/RNA helicase

IPR006576 1728 1768 SM00592 BRK

ProfileScan IPR001650 113 282 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	1	77	PF00176	SNF2-related
IPR001650	144	223	PF00271	DNA/RNA helicase
IPR006576	1728	1768	PF07533	BRK
HMMSmart	IPR001650	139	223	SM00490	DNA/RNA helicase
IPR006576	1728	1768	SM00592	BRK
ProfileScan	IPR001650	113	282	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGAAAGAACCTGCCTAAGC

Primer_r
: GCAACATTTCCAAGGGTCCTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1989 bp
Genome contig ID	gi51511747r_39364658
PolyA signal sequence (AATACA,-14)	+--------+--------+----*----+---- GTATTTGCCCTAAATCCTTAAAATACAAATGCTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTCCTGTATCTTGAAAGCCTTACTGCAAATGAGTATTATAGACAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	39464658	39546641	23	99.6	Perfect prediction

Primer_f	: TGAGAAAGAACCTGCCTAAGC
Primer_r	: GCAACATTTCCAAGGGTCCTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1335

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information