HUGE |
Gene/Protein Characteristic Table for KIAA1335 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04549 |
---|---|
Accession No. : | AB037756 |
Description : | Chromodomain-helicase-DNA-binding protein 6. |
HUGO Gene Name : | chromodomain helicase DNA binding protein 6 (CHD6) |
Clone Name : | bf00973 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced fh16079, former representative clones for KIAA1335 with bf00973. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8116 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1989 bp Genome contig ID gi51511747r_39364658 PolyA signal sequence
(AATACA,-14) +----*----+----*----+----*----+----
GTATTTGCCCTAAATCCTTAAAATACAAATGCTATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAATTCCTGTATCTTGAAAGCCTTACTGCAAATGAGTATTATAGACAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 39464658 39546641 23 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2041 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGAGAAAGAACCTGCCTAAGC | |
: GCAACATTTCCAAGGGTCCTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |