HUGE

Gene/Protein Characteristic Table for KIAA1416

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04550
Accession No. :	AB037837
Description :	Chromodomain-helicase-DNA-binding protein 7.
HUGO Gene Name :	chromodomain helicase DNA binding protein 7 (CHD7)
Clone Name :	hh02957s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh02957, former representative clones for KIAA1416 with hh02957s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5901 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi51511724f_61775549
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAAGAAGGCCCAAAAGTGAGATCGCCAGAGCAGCC
Flanking genome sequence
(164692 - 164741)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCGCTGCTGTGGCCTCCACGTCAGGGATCAACCCTTTGCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 61875549 61940239 34 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1966 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2D1	100.0	Chromodomain-he...	Homo sapiens
XP_519780	99.9	chromodomain he...	Pan troglodytes
EAW86831	99.9	chromodomain he...	Homo sapiens
EAW86830	99.9	chromodomain he...	Homo sapiens
XP_001915803	97.5	similar to Chro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046784	0	59.2	KIAA1564
AB002306	0	60.2	KIAA0308
AB037756	3.1e-152	47.8	KIAA1335
AB007913	2.6e-25	33.5	KIAA0444
AB002307	8.2e-17	30.9	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000953 38 100 PF00385 Chromo

IPR000953 120 173 PF00385 Chromo

IPR000330 209 496 PF00176 SNF2-related

IPR001650 563 642 PF00271 DNA/RNA helicase

IPR006576 1802 1851 PF07533 BRK

IPR006576 1880 1924 PF07533 BRK

HMMSmart IPR000953 37 102 SM00298 Chromo

IPR000953 118 175 SM00298 Chromo

IPR014001 202 403 SM00487 DEAD-like helicases

IPR001650 558 642 SM00490 DNA/RNA helicase

IPR006576 1802 1851 SM00592 BRK

IPR006576 1880 1924 SM00592 BRK

ProfileScan IPR000953 38 105 PS50013 Chromo

IPR000953 120 185 PS50013 Chromo

IPR014021 218 392 PS51192 Helicase

IPR001650 532 702 PS51194 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000953	38	100	PF00385	Chromo
IPR000953	120	173	PF00385	Chromo
IPR000330	209	496	PF00176	SNF2-related
IPR001650	563	642	PF00271	DNA/RNA helicase
IPR006576	1802	1851	PF07533	BRK
IPR006576	1880	1924	PF07533	BRK
HMMSmart	IPR000953	37	102	SM00298	Chromo
IPR000953	118	175	SM00298	Chromo
IPR014001	202	403	SM00487	DEAD-like helicases
IPR001650	558	642	SM00490	DNA/RNA helicase
IPR006576	1802	1851	SM00592	BRK
IPR006576	1880	1924	SM00592	BRK
ProfileScan	IPR000953	38	105	PS50013	Chromo
IPR000953	120	185	PS50013	Chromo
IPR014021	218	392	PS51192	Helicase
IPR001650	532	702	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCAGAAACCGAAACAGAAACG

Primer_r
: GACTCAGGAACAAAACCAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGGGCCTGGATAAAGCTGTG
Primer_r	: TTTAGACCCTTCATCCTCCTC
PCR product length	: 150 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi51511724f_61775549
PolyA signal sequence (None)	+--------+--------+----*----+---- GAAGAAGGCCCAAAAGTGAGATCGCCAGAGCAGCC
Flanking genome sequence (164692 - 164741)	----+--------+--------+--------+--------+----* GCGGCCGCCGCTGCTGTGGCCTCCACGTCAGGGATCAACCCTTTGCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	61875549	61940239	34	100.0	Perfect prediction

Primer_f	: TCAGAAACCGAAACAGAAACG
Primer_r	: GACTCAGGAACAAAACCAGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1416

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information