HUGE |
Gene/Protein Characteristic Table for KIAA1416 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04550 |
---|---|
Accession No. : | AB037837 |
Description : | Chromodomain-helicase-DNA-binding protein 7. |
HUGO Gene Name : | chromodomain helicase DNA binding protein 7 (CHD7) |
Clone Name : | hh02957s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh02957, former representative clones for KIAA1416 with hh02957s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5901 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 0 bp Genome contig ID gi51511724f_61775549 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAAGAAGGCCCAAAAGTGAGATCGCCAGAGCAGCCFlanking genome sequence
(164692 - 164741) ----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCGCTGCTGTGGCCTCCACGTCAGGGATCAACCCTTTGCTGGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 61875549 61940239 34 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1966 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCAGAAACCGAAACAGAAACG | |
: GACTCAGGAACAAAACCAGAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: GeneBridge 4 | |
: CTGGGCCTGGATAAAGCTGTG | |
: TTTAGACCCTTCATCCTCCTC | |
: 150 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |