HUGE |
Gene/Protein Characteristic Table for KIAA1076 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06786 |
---|---|
Accession No. : | AB028999 |
Description : | SET domain-containing protein 1B (Fragment). |
HUGO Gene Name : | SET domain containing 1B (SETD1B) |
Clone Name : | hj06779 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4833 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2417 bp Genome contig ID gi89161190f_120641760 PolyA signal sequence
(CATAAA,-26) +----*----+----*----+----*----+----
AAAGCAAACCATAAATATACTGACTTTTCTTACAGFlanking genome sequence
(113186 - 113235) ----+----*----+----*----+----*----+----*----+----*
ATACGCCGTCTCTCTTGCTCTCCTCTCTCCCTCTCCTCTTTATTCTTTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 120741760 120754944 7 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 804 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001214 | 659 | 788 | PF00856 | SET |
HMMSmart | IPR001214 | 665 | 788 | SM00317 | SET |
IPR003616 | 788 | 804 | SM00508 | Post-SET zinc-binding region | |
ProfileScan | IPR001214 | 664 | 786 | PS50280 | SET |
IPR003616 | 788 | 804 | PS50868 | Post-SET zinc-binding region |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCATCGTGCCCAGTGTTAACC | |
: AATAGCAGAAACCCCCAACTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: CCATCGTGCCCAGTGTTAACC | |
: AATAGCAGAAACCCCCAACTC | |
: 185 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |