HUGE

Gene/Protein Characteristic Table for KIAA1076

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06786
Accession No. :	AB028999
Description :	SET domain-containing protein 1B (Fragment).
HUGO Gene Name :	SET domain containing 1B (SETD1B)
Clone Name :	hj06779 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4833 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2417 bp

Genome contig ID gi89161190f_120641760
PolyA signal sequence
(CATAAA,-26)
+----*----+----*----+----*----+----
AAAGCAAACCATAAATATACTGACTTTTCTTACAG
Flanking genome sequence
(113186 - 113235)
----+----*----+----*----+----*----+----*----+----*
ATACGCCGTCTCTCTTGCTCTCCTCTCTCCCTCTCCTCTTTATTCTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 120741760 120754944 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 804 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98290	2.6e-209	100.0	hCG1812756 [Hom...	Homo sapiens
Q9UPS6	3.9e-209	100.0	Histone-lysine ...	Homo sapiens
XP_543382	2e-182	88.7	similar to CG40...	Canis lupus fam...
AAH40775	1.8e-174	85.0	Setd1b protein ...	Mus musculus
AAH41681	1.8e-174	85.0	Setd1b protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002337	1.4e-25	40.8	KIAA0339
AB002302	8.4e-08	29.3	KIAA0304
AB007927	0.00026	25.8	KIAA0458

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001214 659 788 PF00856 SET

HMMSmart IPR001214 665 788 SM00317 SET

IPR003616 788 804 SM00508 Post-SET zinc-binding region

ProfileScan IPR001214 664 786 PS50280 SET

IPR003616 788 804 PS50868 Post-SET zinc-binding region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001214	659	788	PF00856	SET
HMMSmart	IPR001214	665	788	SM00317	SET
IPR003616	788	804	SM00508	Post-SET zinc-binding region
ProfileScan	IPR001214	664	786	PS50280	SET
IPR003616	788	804	PS50868	Post-SET zinc-binding region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCATCGTGCCCAGTGTTAACC

Primer_r
: AATAGCAGAAACCCCCAACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCATCGTGCCCAGTGTTAACC
Primer_r	: AATAGCAGAAACCCCCAACTC
PCR product length	: 185 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2417 bp
Genome contig ID	gi89161190f_120641760
PolyA signal sequence (CATAAA,-26)	+--------+--------+----*----+---- AAAGCAAACCATAAATATACTGACTTTTCTTACAG
Flanking genome sequence (113186 - 113235)	----+--------+--------+--------+--------+----* ATACGCCGTCTCTCTTGCTCTCCTCTCTCCCTCTCCTCTTTATTCTTTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	120741760	120754944	7	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1076

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information